| Variant ID: vg0208480800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8480800 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACTACGAGTCAATACTACAGATCGCCAAATCGACAACAGTTAGATAGGCTACCCCAAATATTGTACTGGTGTGATTATGGTGAATAAGAGCAATACCGG[C/T]
TTCGGCCAACAGGAGTAGAGTTATTACCTGACAATTCAGGGGCCCGAACCTATATAAAAATCCTCGTCCCCATCTCTTTTACTACAATATTGCATATATC
GATATATGCAATATTGTAGTAAAAGAGATGGGGACGAGGATTTTTATATAGGTTCGGGCCCCTGAATTGTCAGGTAATAACTCTACTCCTGTTGGCCGAA[G/A]
CCGGTATTGCTCTTATTCACCATAATCACACCAGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGATTTGGCGATCTGTAGTATTGACTCGTAGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.50% | 14.20% | 1.25% | 9.08% | NA |
| All Indica | 2759 | 76.40% | 14.50% | 1.38% | 7.72% | NA |
| All Japonica | 1512 | 85.40% | 1.50% | 1.12% | 12.04% | NA |
| Aus | 269 | 27.50% | 65.80% | 0.00% | 6.69% | NA |
| Indica I | 595 | 75.10% | 1.20% | 3.36% | 20.34% | NA |
| Indica II | 465 | 79.10% | 17.00% | 0.22% | 3.66% | NA |
| Indica III | 913 | 72.80% | 23.00% | 1.20% | 2.96% | NA |
| Indica Intermediate | 786 | 79.80% | 13.40% | 0.76% | 6.11% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 0.00% | 1.83% | NA |
| Tropical Japonica | 504 | 62.70% | 3.20% | 2.78% | 31.35% | NA |
| Japonica Intermediate | 241 | 92.10% | 2.50% | 1.24% | 4.15% | NA |
| VI/Aromatic | 96 | 31.20% | 58.30% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 72.20% | 16.70% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208480800 | C -> T | LOC_Os02g15210.1 | upstream_gene_variant ; 208.0bp to feature; MODIFIER | silent_mutation | Average:28.439; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0208480800 | C -> T | LOC_Os02g15200.1 | downstream_gene_variant ; 1193.0bp to feature; MODIFIER | silent_mutation | Average:28.439; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0208480800 | C -> T | LOC_Os02g15200-LOC_Os02g15210 | intergenic_region ; MODIFIER | silent_mutation | Average:28.439; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0208480800 | C -> DEL | N | N | silent_mutation | Average:28.439; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208480800 | NA | 1.34E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208480800 | NA | 2.04E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208480800 | NA | 1.33E-06 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208480800 | 8.56E-06 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208480800 | 2.65E-06 | NA | mr1748_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |