\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208439342:

Variant ID: vg0208439342 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8439342
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TGATGGATCCTATATATTCGTGAGGGGTGTGACCGGTGGAGGTATTGCATCACGTGAGAAACCCTAGCCATCACTCCCCTCCCCGAGCAAAACCCTAGAC[A/G]
CGCGCGGGTGCTAGCACATCTGCGCGTGGCGTTCCATCCCTGTACGTGTGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGCTGATCGGCGTGGGAATA

Reverse complement sequence

TATTCCCACGCCGATCAGCACCGCAAACCAGCGGCGCCTCTACCGGTATCCACACGTACAGGGATGGAACGCCACGCGCAGATGTGCTAGCACCCGCGCG[T/C]
GTCTAGGGTTTTGCTCGGGGAGGGGAGTGATGGCTAGGGTTTCTCACGTGATGCAATACCTCCACCGGTCACACCCCTCACGAATATATAGGATCCATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 28.80% 0.23% 15.64% NA
All Indica  2759 79.40% 3.60% 0.22% 16.85% NA
All Japonica  1512 3.00% 80.80% 0.26% 15.94% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 61.80% 1.70% 0.34% 36.13% NA
Indica II  465 89.90% 1.50% 0.22% 8.39% NA
Indica III  913 88.60% 0.70% 0.00% 10.73% NA
Indica Intermediate  786 75.70% 9.50% 0.38% 14.38% NA
Temperate Japonica  767 1.80% 95.80% 0.00% 2.35% NA
Tropical Japonica  504 4.40% 53.80% 0.79% 41.07% NA
Japonica Intermediate  241 4.10% 89.20% 0.00% 6.64% NA
VI/Aromatic  96 61.50% 14.60% 1.04% 22.92% NA
Intermediate  90 60.00% 28.90% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208439342 A -> G LOC_Os02g15140.1 downstream_gene_variant ; 2635.0bp to feature; MODIFIER silent_mutation Average:26.039; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0208439342 A -> G LOC_Os02g15140-LOC_Os02g15150 intergenic_region ; MODIFIER silent_mutation Average:26.039; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0208439342 A -> DEL N N silent_mutation Average:26.039; most accessible tissue: Minghui63 flower, score: 52.791 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208439342 NA 5.57E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 2.35E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 4.61E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 4.10E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 9.98E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 8.89E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 1.19E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 2.34E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 1.33E-06 3.96E-06 mr1748_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208439342 NA 3.91E-07 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251