\
| Variant ID: vg0208439342 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8439342 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 55. )
TGATGGATCCTATATATTCGTGAGGGGTGTGACCGGTGGAGGTATTGCATCACGTGAGAAACCCTAGCCATCACTCCCCTCCCCGAGCAAAACCCTAGAC[A/G]
CGCGCGGGTGCTAGCACATCTGCGCGTGGCGTTCCATCCCTGTACGTGTGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGCTGATCGGCGTGGGAATA
TATTCCCACGCCGATCAGCACCGCAAACCAGCGGCGCCTCTACCGGTATCCACACGTACAGGGATGGAACGCCACGCGCAGATGTGCTAGCACCCGCGCG[T/C]
GTCTAGGGTTTTGCTCGGGGAGGGGAGTGATGGCTAGGGTTTCTCACGTGATGCAATACCTCCACCGGTCACACCCCTCACGAATATATAGGATCCATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.30% | 28.80% | 0.23% | 15.64% | NA |
| All Indica | 2759 | 79.40% | 3.60% | 0.22% | 16.85% | NA |
| All Japonica | 1512 | 3.00% | 80.80% | 0.26% | 15.94% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 61.80% | 1.70% | 0.34% | 36.13% | NA |
| Indica II | 465 | 89.90% | 1.50% | 0.22% | 8.39% | NA |
| Indica III | 913 | 88.60% | 0.70% | 0.00% | 10.73% | NA |
| Indica Intermediate | 786 | 75.70% | 9.50% | 0.38% | 14.38% | NA |
| Temperate Japonica | 767 | 1.80% | 95.80% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 4.40% | 53.80% | 0.79% | 41.07% | NA |
| Japonica Intermediate | 241 | 4.10% | 89.20% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 61.50% | 14.60% | 1.04% | 22.92% | NA |
| Intermediate | 90 | 60.00% | 28.90% | 0.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208439342 | A -> G | LOC_Os02g15140.1 | downstream_gene_variant ; 2635.0bp to feature; MODIFIER | silent_mutation | Average:26.039; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0208439342 | A -> G | LOC_Os02g15140-LOC_Os02g15150 | intergenic_region ; MODIFIER | silent_mutation | Average:26.039; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0208439342 | A -> DEL | N | N | silent_mutation | Average:26.039; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208439342 | NA | 5.57E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 2.35E-17 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 4.61E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 4.10E-11 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 9.98E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 8.89E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 1.19E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 2.34E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | 1.33E-06 | 3.96E-06 | mr1748_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208439342 | NA | 3.91E-07 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |