\
| Variant ID: vg0208432932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8432932 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )
TGCACCTAATGTGAACATTTTAATTTGTAGGGAGAGGTACTATGGGCTTAACTTTCCTCGGTTGCCCAGCAACTTACCAACAACAATTCCAACAATTTTC[G/A]
CCTCAATGGCAAAGTGAAAGCCAAAAGTTTAGGGGCGAGCACCAAAAGATCTATCAATTTAGACAAGGAGATATTATTCCACTCCCAGCTGGTGTTGCAC
GTGCAACACCAGCTGGGAGTGGAATAATATCTCCTTGTCTAAATTGATAGATCTTTTGGTGCTCGCCCCTAAACTTTTGGCTTTCACTTTGCCATTGAGG[C/T]
GAAAATTGTTGGAATTGTTGTTGGTAAGTTGCTGGGCAACCGAGGAAAGTTAAGCCCATAGTACCTCTCCCTACAAATTAAAATGTTCACATTAGGTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.10% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 6.50% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 85.80% | 11.00% | 3.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 5.80% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208432932 | G -> A | LOC_Os02g15140.1 | upstream_gene_variant ; 526.0bp to feature; MODIFIER | silent_mutation | Average:36.278; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| vg0208432932 | G -> A | LOC_Os02g15130.1 | downstream_gene_variant ; 3658.0bp to feature; MODIFIER | silent_mutation | Average:36.278; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| vg0208432932 | G -> A | LOC_Os02g15130-LOC_Os02g15140 | intergenic_region ; MODIFIER | silent_mutation | Average:36.278; most accessible tissue: Zhenshan97 flower, score: 45.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208432932 | NA | 5.00E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208432932 | 7.75E-06 | 1.02E-06 | mr1236 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208432932 | NA | 3.99E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208432932 | NA | 1.26E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208432932 | NA | 2.89E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208432932 | NA | 1.97E-06 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208432932 | 2.00E-06 | 2.00E-06 | mr1996 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |