\
| Variant ID: vg0208396236 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8396236 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 309. )
TGTTTGTTCATCTGCATAGCACGGTCAACCTGGTACATCACATATTTCCACGTGTGATTGTTACATTGTATTGATTTGTATTTGTTCATCTTTTGTTGAT[T/C]
GAATACATGCGAATCACTAAACTATCGCTTTGTTTCTTCGAGCAGAAGCAGAATGTCCATTTAGGGTTTGTTTGGTTCCCGGTCAAGGTTGGATGGGAGA
TCTCCCATCCAACCTTGACCGGGAACCAAACAAACCCTAAATGGACATTCTGCTTCTGCTCGAAGAAACAAAGCGATAGTTTAGTGATTCGCATGTATTC[A/G]
ATCAACAAAAGATGAACAAATACAAATCAATACAATGTAACAATCACACGTGGAAATATGTGATGTACCAGGTTGACCGTGCTATGCAGATGAACAAACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 1.70% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 90.40% | 5.30% | 4.30% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 83.10% | 9.90% | 7.04% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 1.70% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208396236 | T -> C | LOC_Os02g15040.1 | downstream_gene_variant ; 4088.0bp to feature; MODIFIER | silent_mutation | Average:65.093; most accessible tissue: Callus, score: 82.219 | N | N | N | N |
| vg0208396236 | T -> C | LOC_Os02g15050.1 | downstream_gene_variant ; 1091.0bp to feature; MODIFIER | silent_mutation | Average:65.093; most accessible tissue: Callus, score: 82.219 | N | N | N | N |
| vg0208396236 | T -> C | LOC_Os02g15060.1 | downstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:65.093; most accessible tissue: Callus, score: 82.219 | N | N | N | N |
| vg0208396236 | T -> C | LOC_Os02g15070.1 | downstream_gene_variant ; 4959.0bp to feature; MODIFIER | silent_mutation | Average:65.093; most accessible tissue: Callus, score: 82.219 | N | N | N | N |
| vg0208396236 | T -> C | LOC_Os02g15050-LOC_Os02g15060 | intergenic_region ; MODIFIER | silent_mutation | Average:65.093; most accessible tissue: Callus, score: 82.219 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208396236 | NA | 1.69E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | NA | 3.66E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | 2.18E-07 | NA | mr1309 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | NA | 1.96E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | NA | 1.44E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | NA | 5.36E-08 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | NA | 6.49E-07 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | 4.32E-06 | NA | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | 5.62E-06 | 5.62E-06 | mr1996 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | NA | 6.41E-06 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208396236 | 8.15E-06 | NA | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |