\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208396236:

Variant ID: vg0208396236 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8396236
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTTGTTCATCTGCATAGCACGGTCAACCTGGTACATCACATATTTCCACGTGTGATTGTTACATTGTATTGATTTGTATTTGTTCATCTTTTGTTGAT[T/C]
GAATACATGCGAATCACTAAACTATCGCTTTGTTTCTTCGAGCAGAAGCAGAATGTCCATTTAGGGTTTGTTTGGTTCCCGGTCAAGGTTGGATGGGAGA

Reverse complement sequence

TCTCCCATCCAACCTTGACCGGGAACCAAACAAACCCTAAATGGACATTCTGCTTCTGCTCGAAGAAACAAAGCGATAGTTTAGTGATTCGCATGTATTC[A/G]
ATCAACAAAAGATGAACAAATACAAATCAATACAATGTAACAATCACACGTGGAAATATGTGATGTACCAGGTTGACCGTGCTATGCAGATGAACAAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 1.70% 1.44% 0.00% NA
All Indica  2759 99.90% 0.00% 0.11% 0.00% NA
All Japonica  1512 90.40% 5.30% 4.30% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.00% 0.38% 0.00% NA
Temperate Japonica  767 83.10% 9.90% 7.04% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 1.70% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208396236 T -> C LOC_Os02g15040.1 downstream_gene_variant ; 4088.0bp to feature; MODIFIER silent_mutation Average:65.093; most accessible tissue: Callus, score: 82.219 N N N N
vg0208396236 T -> C LOC_Os02g15050.1 downstream_gene_variant ; 1091.0bp to feature; MODIFIER silent_mutation Average:65.093; most accessible tissue: Callus, score: 82.219 N N N N
vg0208396236 T -> C LOC_Os02g15060.1 downstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:65.093; most accessible tissue: Callus, score: 82.219 N N N N
vg0208396236 T -> C LOC_Os02g15070.1 downstream_gene_variant ; 4959.0bp to feature; MODIFIER silent_mutation Average:65.093; most accessible tissue: Callus, score: 82.219 N N N N
vg0208396236 T -> C LOC_Os02g15050-LOC_Os02g15060 intergenic_region ; MODIFIER silent_mutation Average:65.093; most accessible tissue: Callus, score: 82.219 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208396236 NA 1.69E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 NA 3.66E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 2.18E-07 NA mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 NA 1.96E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 NA 1.44E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 NA 5.36E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 NA 6.49E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 4.32E-06 NA mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 5.62E-06 5.62E-06 mr1996 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 NA 6.41E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208396236 8.15E-06 NA mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251