Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0208337162:

Variant ID: vg0208337162 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 8337162
Reference Allele: C	Alternative Allele: T,CAT,CA,CT,CTT,CATT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGACCACTGTTCTTCATTTTTGCCGGCCGGAAGTTTCGGTGTTCTTTCACCCGGAACCTCCGGGCGCTGTCCAGCCAGCCAGCCACTCTTGATTCTCT[C/T,CAT,CA,CT,CTT,CATT]
TTTTTTTTTACCTAACTACTGCACTCCAATTTATTGATTCCTGTTGCAGTAAGCACTATGACTCGTGAGAAAAGACAGAAAGCTTCTCAGGATGTGTCCG

Reverse complement sequence

CGGACACATCCTGAGAAGCTTTCTGTCTTTTCTCACGAGTCATAGTGCTTACTGCAACAGGAATCAATAAATTGGAGTGCAGTAGTTAGGTAAAAAAAAA[G/A,ATG,TG,AG,AAG,AATG]
AGAGAATCAAGAGTGGCTGGCTGGCTGGACAGCGCCCGGAGGTTCCGGGTGAAAGAACACCGAAACTTCCGGCCGGCAAAAATGAAGAACAGTGGTCTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	8.60%	10.77%	7.30%	CAT: 7.64%; CT: 3.98%; CA: 0.78%; CTT: 0.02%; CATT: 0.02%
All Indica	2759	60.40%	14.20%	13.81%	0.65%	CT: 6.38%; CAT: 3.55%; CA: 1.01%
All Japonica	1512	70.10%	0.60%	7.80%	20.11%	CT: 0.66%; CAT: 0.66%; CTT: 0.07%
Aus	269	27.50%	0.00%	0.00%	0.00%	CAT: 69.52%; CA: 2.97%
Indica I	595	57.50%	4.90%	31.60%	1.68%	CA: 3.19%; CAT: 0.84%; CT: 0.34%
Indica II	465	53.80%	33.50%	4.95%	0.00%	CT: 6.67%; CAT: 1.08%
Indica III	913	62.50%	11.40%	8.76%	0.66%	CT: 11.28%; CAT: 5.15%; CA: 0.22%
Indica Intermediate	786	64.10%	13.00%	11.45%	0.25%	CAT: 5.22%; CT: 5.09%; CA: 0.89%
Temperate Japonica	767	82.40%	0.70%	1.83%	15.12%	NA
Tropical Japonica	504	43.30%	0.20%	19.44%	33.93%	CT: 1.98%; CAT: 1.19%
Japonica Intermediate	241	87.10%	1.20%	2.49%	7.05%	CAT: 1.66%; CTT: 0.41%
VI/Aromatic	96	19.80%	0.00%	4.17%	21.88%	CAT: 53.12%; CATT: 1.04%
Intermediate	90	65.60%	5.60%	6.67%	2.22%	CAT: 16.67%; CT: 2.22%; CA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208337162	C -> T	LOC_Os02g14929.1	intron_variant ; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0208337162	C -> DEL	N	N	silent_mutation	Average:40.224; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0208337162	C -> CA	LOC_Os02g14929.1	intron_variant ; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0208337162	C -> CT	LOC_Os02g14929.1	intron_variant ; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0208337162	C -> CATT	LOC_Os02g14929.1	intron_variant ; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0208337162	C -> CAT	LOC_Os02g14929.1	intron_variant ; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0208337162	C -> CTT	LOC_Os02g14929.1	intron_variant ; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208337162	1.54E-06	1.15E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208337162	NA	6.79E-06	mr1510	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208337162	6.11E-06	NA	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208337162	8.41E-06	NA	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208337162	8.80E-06	8.82E-06	mr1994	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208337162	8.47E-06	8.47E-06	mr1994	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251