\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208321255:

Variant ID: vg0208321255 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8321255
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGTGGCGTCCATCCTGGCCCCTCGACGGTGGCGACTCTTGTGAATTTGATTGGGGGAATCGATGGTGGCCTAGATGTGATGGGGGAGCGGCTCGCCAA[C/T]
GCATCGAGCAAGCTTTTTTTTTTTTGCATTCGTGCAACATTAAAGGTATTGGTTCCTAAATCAATACCTTTGATTCCTCCTGTGAGGTGTCGGTTGGAAA

Reverse complement sequence

TTTCCAACCGACACCTCACAGGAGGAATCAAAGGTATTGATTTAGGAACCAATACCTTTAATGTTGCACGAATGCAAAAAAAAAAAAGCTTGCTCGATGC[G/A]
TTGGCGAGCCGCTCCCCCATCACATCTAGGCCACCATCGATTCCCCCAATCAAATTCACAAGAGTCGCCACCGTCGAGGGGCCAGGATGGACGCCACAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.00% 26.90% 1.44% 0.70% NA
All Indica  2759 94.20% 2.90% 1.78% 1.16% NA
All Japonica  1512 22.80% 76.10% 1.12% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.10% 1.80% 5.04% 0.00% NA
Indica II  465 97.00% 1.70% 0.65% 0.65% NA
Indica III  913 96.80% 0.70% 0.44% 2.08% NA
Indica Intermediate  786 90.20% 7.00% 1.53% 1.27% NA
Temperate Japonica  767 4.40% 95.40% 0.13% 0.00% NA
Tropical Japonica  504 56.50% 41.10% 2.38% 0.00% NA
Japonica Intermediate  241 10.80% 87.60% 1.66% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 67.80% 28.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208321255 C -> T LOC_Os02g14910.1 upstream_gene_variant ; 2636.0bp to feature; MODIFIER silent_mutation Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0208321255 C -> T LOC_Os02g14900.1 downstream_gene_variant ; 4064.0bp to feature; MODIFIER silent_mutation Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0208321255 C -> T LOC_Os02g14929.1 downstream_gene_variant ; 4828.0bp to feature; MODIFIER silent_mutation Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0208321255 C -> T LOC_Os02g14900-LOC_Os02g14910 intergenic_region ; MODIFIER silent_mutation Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0208321255 C -> DEL N N silent_mutation Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208321255 NA 2.07E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 NA 8.82E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 7.00E-07 NA mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 3.08E-06 1.60E-07 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 NA 7.97E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 NA 5.77E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 NA 3.51E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 NA 1.95E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208321255 NA 1.39E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251