\
| Variant ID: vg0208321255 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8321255 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTGTGGCGTCCATCCTGGCCCCTCGACGGTGGCGACTCTTGTGAATTTGATTGGGGGAATCGATGGTGGCCTAGATGTGATGGGGGAGCGGCTCGCCAA[C/T]
GCATCGAGCAAGCTTTTTTTTTTTTGCATTCGTGCAACATTAAAGGTATTGGTTCCTAAATCAATACCTTTGATTCCTCCTGTGAGGTGTCGGTTGGAAA
TTTCCAACCGACACCTCACAGGAGGAATCAAAGGTATTGATTTAGGAACCAATACCTTTAATGTTGCACGAATGCAAAAAAAAAAAAGCTTGCTCGATGC[G/A]
TTGGCGAGCCGCTCCCCCATCACATCTAGGCCACCATCGATTCCCCCAATCAAATTCACAAGAGTCGCCACCGTCGAGGGGCCAGGATGGACGCCACAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.00% | 26.90% | 1.44% | 0.70% | NA |
| All Indica | 2759 | 94.20% | 2.90% | 1.78% | 1.16% | NA |
| All Japonica | 1512 | 22.80% | 76.10% | 1.12% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 1.80% | 5.04% | 0.00% | NA |
| Indica II | 465 | 97.00% | 1.70% | 0.65% | 0.65% | NA |
| Indica III | 913 | 96.80% | 0.70% | 0.44% | 2.08% | NA |
| Indica Intermediate | 786 | 90.20% | 7.00% | 1.53% | 1.27% | NA |
| Temperate Japonica | 767 | 4.40% | 95.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 56.50% | 41.10% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.80% | 87.60% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 28.90% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208321255 | C -> T | LOC_Os02g14910.1 | upstream_gene_variant ; 2636.0bp to feature; MODIFIER | silent_mutation | Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0208321255 | C -> T | LOC_Os02g14900.1 | downstream_gene_variant ; 4064.0bp to feature; MODIFIER | silent_mutation | Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0208321255 | C -> T | LOC_Os02g14929.1 | downstream_gene_variant ; 4828.0bp to feature; MODIFIER | silent_mutation | Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0208321255 | C -> T | LOC_Os02g14900-LOC_Os02g14910 | intergenic_region ; MODIFIER | silent_mutation | Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| vg0208321255 | C -> DEL | N | N | silent_mutation | Average:70.482; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208321255 | NA | 2.07E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | NA | 8.82E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | 7.00E-07 | NA | mr1174_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | 3.08E-06 | 1.60E-07 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | NA | 7.97E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | NA | 5.77E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | NA | 3.51E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | NA | 1.95E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208321255 | NA | 1.39E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |