\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208267970:

Variant ID: vg0208267970 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8267970
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CGCACATTAGGGTTAGGGGAGGGATCACGGGTGGAGAGGGTAGCGGGGCGTGGGTCGGGTGGGATGAGGCGGCGGGTGTCAGAGGGATGTGGAGTCAATC[G/A]
TGACCATCTAATTATTGTATATGTACGTGGGACATTGGATTTGATGAATAAGTAATATAAGTGTCAGTTGTATATGTACATGAGACCCCGCTCAGTTGGT

Reverse complement sequence

ACCAACTGAGCGGGGTCTCATGTACATATACAACTGACACTTATATTACTTATTCATCAAATCCAATGTCCCACGTACATATACAATAATTAGATGGTCA[C/T]
GATTGACTCCACATCCCTCTGACACCCGCCGCCTCATCCCACCCGACCCACGCCCCGCTACCCTCTCCACCCGTGATCCCTCCCCTAACCCTAATGTGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 24.30% 0.21% 22.18% NA
All Indica  2759 76.10% 1.30% 0.25% 22.29% NA
All Japonica  1512 2.90% 71.30% 0.13% 25.66% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 59.50% 0.50% 0.50% 39.50% NA
Indica II  465 91.60% 1.10% 0.00% 7.31% NA
Indica III  913 80.20% 1.50% 0.11% 18.18% NA
Indica Intermediate  786 74.80% 1.90% 0.38% 22.90% NA
Temperate Japonica  767 1.60% 94.80% 0.00% 3.65% NA
Tropical Japonica  504 4.40% 36.70% 0.40% 58.53% NA
Japonica Intermediate  241 4.10% 68.90% 0.00% 26.97% NA
VI/Aromatic  96 60.40% 5.20% 1.04% 33.33% NA
Intermediate  90 55.60% 31.10% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208267970 G -> A LOC_Os02g14860.1 downstream_gene_variant ; 2247.0bp to feature; MODIFIER silent_mutation Average:51.61; most accessible tissue: Callus, score: 87.179 N N N N
vg0208267970 G -> A LOC_Os02g14870.1 downstream_gene_variant ; 263.0bp to feature; MODIFIER silent_mutation Average:51.61; most accessible tissue: Callus, score: 87.179 N N N N
vg0208267970 G -> A LOC_Os02g14860-LOC_Os02g14870 intergenic_region ; MODIFIER silent_mutation Average:51.61; most accessible tissue: Callus, score: 87.179 N N N N
vg0208267970 G -> DEL N N silent_mutation Average:51.61; most accessible tissue: Callus, score: 87.179 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208267970 NA 3.09E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 3.65E-19 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 7.23E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 7.00E-13 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 3.40E-06 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 7.18E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 2.22E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 7.27E-11 mr1134_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 1.42E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 5.48E-13 mr1504_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 1.55E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 1.33E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 6.53E-07 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267970 NA 2.43E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251