\
| Variant ID: vg0208267970 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8267970 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 81. )
CGCACATTAGGGTTAGGGGAGGGATCACGGGTGGAGAGGGTAGCGGGGCGTGGGTCGGGTGGGATGAGGCGGCGGGTGTCAGAGGGATGTGGAGTCAATC[G/A]
TGACCATCTAATTATTGTATATGTACGTGGGACATTGGATTTGATGAATAAGTAATATAAGTGTCAGTTGTATATGTACATGAGACCCCGCTCAGTTGGT
ACCAACTGAGCGGGGTCTCATGTACATATACAACTGACACTTATATTACTTATTCATCAAATCCAATGTCCCACGTACATATACAATAATTAGATGGTCA[C/T]
GATTGACTCCACATCCCTCTGACACCCGCCGCCTCATCCCACCCGACCCACGCCCCGCTACCCTCTCCACCCGTGATCCCTCCCCTAACCCTAATGTGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 24.30% | 0.21% | 22.18% | NA |
| All Indica | 2759 | 76.10% | 1.30% | 0.25% | 22.29% | NA |
| All Japonica | 1512 | 2.90% | 71.30% | 0.13% | 25.66% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 59.50% | 0.50% | 0.50% | 39.50% | NA |
| Indica II | 465 | 91.60% | 1.10% | 0.00% | 7.31% | NA |
| Indica III | 913 | 80.20% | 1.50% | 0.11% | 18.18% | NA |
| Indica Intermediate | 786 | 74.80% | 1.90% | 0.38% | 22.90% | NA |
| Temperate Japonica | 767 | 1.60% | 94.80% | 0.00% | 3.65% | NA |
| Tropical Japonica | 504 | 4.40% | 36.70% | 0.40% | 58.53% | NA |
| Japonica Intermediate | 241 | 4.10% | 68.90% | 0.00% | 26.97% | NA |
| VI/Aromatic | 96 | 60.40% | 5.20% | 1.04% | 33.33% | NA |
| Intermediate | 90 | 55.60% | 31.10% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208267970 | G -> A | LOC_Os02g14860.1 | downstream_gene_variant ; 2247.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 87.179 | N | N | N | N |
| vg0208267970 | G -> A | LOC_Os02g14870.1 | downstream_gene_variant ; 263.0bp to feature; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 87.179 | N | N | N | N |
| vg0208267970 | G -> A | LOC_Os02g14860-LOC_Os02g14870 | intergenic_region ; MODIFIER | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 87.179 | N | N | N | N |
| vg0208267970 | G -> DEL | N | N | silent_mutation | Average:51.61; most accessible tissue: Callus, score: 87.179 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208267970 | NA | 3.09E-11 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 3.65E-19 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 7.23E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 7.00E-13 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 3.40E-06 | mr1712 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 7.18E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 2.22E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 7.27E-11 | mr1134_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 1.42E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 5.48E-13 | mr1504_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 1.55E-17 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 1.33E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 6.53E-07 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267970 | NA | 2.43E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |