\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208267128:

Variant ID: vg0208267128 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8267128
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGCCATCGCCACCAATCCAAATTCTCGCACCGTCGCAAGGTAGCCACCTCATCCTTCCTTATCCTCTTCCCTCTCTCCACATGCTGCCGTCGCCGCTC[C/T]
AGCGCCCGTCCGCCTCTCCAACCCCCACCTGCCACCGCCACCACTACCGATCTGGCCCCTGCTCCCCGCGCACGTCAAAGGGGAGGAGAAATACGGAAAG

Reverse complement sequence

CTTTCCGTATTTCTCCTCCCCTTTGACGTGCGCGGGGAGCAGGGGCCAGATCGGTAGTGGTGGCGGTGGCAGGTGGGGGTTGGAGAGGCGGACGGGCGCT[G/A]
GAGCGGCGACGGCAGCATGTGGAGAGAGGGAAGAGGATAAGGAAGGATGAGGTGGCTACCTTGCGACGGTGCGAGAATTTGGATTGGTGGCGATGGCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 5.70% 0.55% 21.35% NA
All Indica  2759 68.80% 9.20% 0.80% 21.20% NA
All Japonica  1512 74.10% 0.50% 0.20% 25.13% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 49.90% 10.90% 1.85% 37.31% NA
Indica II  465 69.20% 23.40% 0.43% 6.88% NA
Indica III  913 81.70% 0.40% 0.11% 17.74% NA
Indica Intermediate  786 67.70% 9.80% 1.02% 21.50% NA
Temperate Japonica  767 95.80% 0.50% 0.00% 3.65% NA
Tropical Japonica  504 42.30% 0.20% 0.40% 57.14% NA
Japonica Intermediate  241 71.80% 1.20% 0.41% 26.56% NA
VI/Aromatic  96 66.70% 0.00% 1.04% 32.29% NA
Intermediate  90 80.00% 6.70% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208267128 C -> T LOC_Os02g14860.1 downstream_gene_variant ; 1405.0bp to feature; MODIFIER silent_mutation Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0208267128 C -> T LOC_Os02g14870.1 downstream_gene_variant ; 1105.0bp to feature; MODIFIER silent_mutation Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0208267128 C -> T LOC_Os02g14860-LOC_Os02g14870 intergenic_region ; MODIFIER silent_mutation Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0208267128 C -> DEL N N silent_mutation Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208267128 3.68E-06 3.68E-06 mr1054 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128 5.41E-06 5.41E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128 8.82E-06 8.82E-06 mr1573 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128 7.68E-06 7.68E-06 mr1762 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128 8.60E-07 6.74E-07 mr1906 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128 NA 2.06E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128 NA 2.59E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208267128 NA 8.33E-08 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251