\
| Variant ID: vg0208267128 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8267128 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 88. )
GCTGCCATCGCCACCAATCCAAATTCTCGCACCGTCGCAAGGTAGCCACCTCATCCTTCCTTATCCTCTTCCCTCTCTCCACATGCTGCCGTCGCCGCTC[C/T]
AGCGCCCGTCCGCCTCTCCAACCCCCACCTGCCACCGCCACCACTACCGATCTGGCCCCTGCTCCCCGCGCACGTCAAAGGGGAGGAGAAATACGGAAAG
CTTTCCGTATTTCTCCTCCCCTTTGACGTGCGCGGGGAGCAGGGGCCAGATCGGTAGTGGTGGCGGTGGCAGGTGGGGGTTGGAGAGGCGGACGGGCGCT[G/A]
GAGCGGCGACGGCAGCATGTGGAGAGAGGGAAGAGGATAAGGAAGGATGAGGTGGCTACCTTGCGACGGTGCGAGAATTTGGATTGGTGGCGATGGCAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.40% | 5.70% | 0.55% | 21.35% | NA |
| All Indica | 2759 | 68.80% | 9.20% | 0.80% | 21.20% | NA |
| All Japonica | 1512 | 74.10% | 0.50% | 0.20% | 25.13% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 49.90% | 10.90% | 1.85% | 37.31% | NA |
| Indica II | 465 | 69.20% | 23.40% | 0.43% | 6.88% | NA |
| Indica III | 913 | 81.70% | 0.40% | 0.11% | 17.74% | NA |
| Indica Intermediate | 786 | 67.70% | 9.80% | 1.02% | 21.50% | NA |
| Temperate Japonica | 767 | 95.80% | 0.50% | 0.00% | 3.65% | NA |
| Tropical Japonica | 504 | 42.30% | 0.20% | 0.40% | 57.14% | NA |
| Japonica Intermediate | 241 | 71.80% | 1.20% | 0.41% | 26.56% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 1.04% | 32.29% | NA |
| Intermediate | 90 | 80.00% | 6.70% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208267128 | C -> T | LOC_Os02g14860.1 | downstream_gene_variant ; 1405.0bp to feature; MODIFIER | silent_mutation | Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0208267128 | C -> T | LOC_Os02g14870.1 | downstream_gene_variant ; 1105.0bp to feature; MODIFIER | silent_mutation | Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0208267128 | C -> T | LOC_Os02g14860-LOC_Os02g14870 | intergenic_region ; MODIFIER | silent_mutation | Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0208267128 | C -> DEL | N | N | silent_mutation | Average:49.673; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208267128 | 3.68E-06 | 3.68E-06 | mr1054 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267128 | 5.41E-06 | 5.41E-06 | mr1287 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267128 | 8.82E-06 | 8.82E-06 | mr1573 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267128 | 7.68E-06 | 7.68E-06 | mr1762 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267128 | 8.60E-07 | 6.74E-07 | mr1906 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267128 | NA | 2.06E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267128 | NA | 2.59E-06 | mr1921 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208267128 | NA | 8.33E-08 | mr1982 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |