Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208253186:

Variant ID: vg0208253186 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 8253186
Reference Allele: AAlternative Allele: ATC,C
Primary Allele: ASecondary Allele: ATC

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, C: 0.05, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTCTCGGGAGATTAGTAGTAGGTTCGCCCAGAGGGCAGCGTCCATGCAGCTTCGACAAATGGCCGTCGATGCTGCCACGGCCGCTGTGCCGACCGAC[A/ATC,C]
GATCAACTTCGTGTTGCATGCGCGTTTGTGTAGTTGTGTACTCCCTCCGTTCTAATACAACGAATCTGGATAGAGATGTCTAGATTCGTAGTACTGGATG

Reverse complement sequence

CATCCAGTACTACGAATCTAGACATCTCTATCCAGATTCGTTGTATTAGAACGGAGGGAGTACACAACTACACAAACGCGCATGCAACACGAAGTTGATC[T/GAT,G]
GTCGGTCGGCACAGCGGCCGTGGCAGCATCGACGGCCATTTGTCGAAGCTGCATGGACGCTGCCCTCTGGGCGAACCTACTACTAATCTCCCGAGAGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of ATC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 11.70% 6.28% 4.49% C: 0.34%
All Indica  2759 76.90% 10.80% 7.87% 4.20% C: 0.22%
All Japonica  1512 74.10% 14.60% 4.89% 5.89% C: 0.46%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 59.50% 15.60% 17.65% 7.06% C: 0.17%
Indica II  465 92.50% 3.70% 1.94% 1.72% C: 0.22%
Indica III  913 81.50% 10.40% 3.83% 3.94% C: 0.33%
Indica Intermediate  786 75.70% 11.70% 8.65% 3.82% C: 0.13%
Temperate Japonica  767 96.20% 0.90% 1.69% 1.17% NA
Tropical Japonica  504 41.30% 34.70% 9.33% 13.29% C: 1.39%
Japonica Intermediate  241 72.60% 16.20% 5.81% 5.39% NA
VI/Aromatic  96 65.60% 27.10% 3.12% 4.17% NA
Intermediate  90 83.30% 6.70% 3.33% 3.33% C: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208253186 A -> DEL N N silent_mutation Average:96.053; most accessible tissue: Minghui63 young leaf, score: 99.352 N N N N
vg0208253186 A -> ATC LOC_Os02g14840.1 upstream_gene_variant ; 4743.0bp to feature; MODIFIER silent_mutation Average:96.053; most accessible tissue: Minghui63 young leaf, score: 99.352 N N N N
vg0208253186 A -> ATC LOC_Os02g14850.1 upstream_gene_variant ; 3269.0bp to feature; MODIFIER silent_mutation Average:96.053; most accessible tissue: Minghui63 young leaf, score: 99.352 N N N N
vg0208253186 A -> ATC LOC_Os02g14840-LOC_Os02g14850 intergenic_region ; MODIFIER silent_mutation Average:96.053; most accessible tissue: Minghui63 young leaf, score: 99.352 N N N N
vg0208253186 A -> C LOC_Os02g14840.1 upstream_gene_variant ; 4742.0bp to feature; MODIFIER silent_mutation Average:96.053; most accessible tissue: Minghui63 young leaf, score: 99.352 N N N N
vg0208253186 A -> C LOC_Os02g14850.1 upstream_gene_variant ; 3270.0bp to feature; MODIFIER silent_mutation Average:96.053; most accessible tissue: Minghui63 young leaf, score: 99.352 N N N N
vg0208253186 A -> C LOC_Os02g14840-LOC_Os02g14850 intergenic_region ; MODIFIER silent_mutation Average:96.053; most accessible tissue: Minghui63 young leaf, score: 99.352 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208253186 A ATC -0.72 0.01 0.11 -0.16 -0.04 0.01
vg0208253186 A C 0.04 0.14 0.09 0.01 0.07 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208253186 3.24E-06 NA mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 4.70E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 9.20E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 9.78E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 3.82E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 3.45E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 7.46E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 1.60E-06 mr1751 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208253186 NA 3.84E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251