Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208214479:

Variant ID: vg0208214479 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8214479
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCTTTTGACAGGTAGTTAACACCGTTAACTCCTCCATCCAAAACATGGGCAACAAGATTTTTCGGCTAAAAAAAGTGGGGAAAAACGAAAAGCCTAA[A/G]
AGATAGGGGTAAAATCAATATTGAACATGAAAGTGAGGGAAAAAACAAAATTGTCCCATAGCATTTACATCCTAACATGGTTATTACCACTCTGTTGTAA

Reverse complement sequence

TTACAACAGAGTGGTAATAACCATGTTAGGATGTAAATGCTATGGGACAATTTTGTTTTTTCCCTCACTTTCATGTTCAATATTGATTTTACCCCTATCT[T/C]
TTAGGCTTTTCGTTTTTCCCCACTTTTTTTAGCCGAAAAATCTTGTTGCCCATGTTTTGGATGGAGGAGTTAACGGTGTTAACTACCTGTCAAAAGAACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	38.80%	1.35%	3.39%	NA
All Indica	2759	39.40%	52.70%	2.17%	5.73%	NA
All Japonica	1512	98.10%	1.70%	0.20%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	57.50%	28.90%	3.36%	10.25%	NA
Indica II	465	18.90%	74.00%	1.94%	5.16%	NA
Indica III	913	41.00%	55.40%	0.77%	2.85%	NA
Indica Intermediate	786	36.10%	54.80%	3.05%	5.98%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.40%	0.40%	0.00%	NA
Japonica Intermediate	241	96.30%	3.30%	0.41%	0.00%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	54.40%	42.20%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208214479	A -> G	LOC_Os02g14800.4	3_prime_UTR_variant ; 1127.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Callus, score: 74.451	N	N	N	N
vg0208214479	A -> G	LOC_Os02g14800.5	3_prime_UTR_variant ; 1127.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Callus, score: 74.451	N	N	N	N
vg0208214479	A -> G	LOC_Os02g14800.1	intron_variant ; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Callus, score: 74.451	N	N	N	N
vg0208214479	A -> G	LOC_Os02g14800.2	intron_variant ; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Callus, score: 74.451	N	N	N	N
vg0208214479	A -> G	LOC_Os02g14800.3	intron_variant ; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Callus, score: 74.451	N	N	N	N
vg0208214479	A -> DEL	N	N	silent_mutation	Average:41.455; most accessible tissue: Callus, score: 74.451	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208214479	NA	6.93E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	7.40E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	4.64E-07	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	5.33E-13	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	1.10E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	6.31E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	8.99E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	7.18E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	8.93E-06	1.76E-27	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	5.05E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	1.79E-08	mr1565	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	1.17E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	1.46E-11	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	2.77E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	1.02E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479	NA	3.24E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251