\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208214479:

Variant ID: vg0208214479 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8214479
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCTTTTGACAGGTAGTTAACACCGTTAACTCCTCCATCCAAAACATGGGCAACAAGATTTTTCGGCTAAAAAAAGTGGGGAAAAACGAAAAGCCTAA[A/G]
AGATAGGGGTAAAATCAATATTGAACATGAAAGTGAGGGAAAAAACAAAATTGTCCCATAGCATTTACATCCTAACATGGTTATTACCACTCTGTTGTAA

Reverse complement sequence

TTACAACAGAGTGGTAATAACCATGTTAGGATGTAAATGCTATGGGACAATTTTGTTTTTTCCCTCACTTTCATGTTCAATATTGATTTTACCCCTATCT[T/C]
TTAGGCTTTTCGTTTTTCCCCACTTTTTTTAGCCGAAAAATCTTGTTGCCCATGTTTTGGATGGAGGAGTTAACGGTGTTAACTACCTGTCAAAAGAACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 38.80% 1.35% 3.39% NA
All Indica  2759 39.40% 52.70% 2.17% 5.73% NA
All Japonica  1512 98.10% 1.70% 0.20% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 57.50% 28.90% 3.36% 10.25% NA
Indica II  465 18.90% 74.00% 1.94% 5.16% NA
Indica III  913 41.00% 55.40% 0.77% 2.85% NA
Indica Intermediate  786 36.10% 54.80% 3.05% 5.98% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.40% 0.40% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 54.40% 42.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208214479 A -> G LOC_Os02g14800.4 3_prime_UTR_variant ; 1127.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Callus, score: 74.451 N N N N
vg0208214479 A -> G LOC_Os02g14800.5 3_prime_UTR_variant ; 1127.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Callus, score: 74.451 N N N N
vg0208214479 A -> G LOC_Os02g14800.1 intron_variant ; MODIFIER silent_mutation Average:41.455; most accessible tissue: Callus, score: 74.451 N N N N
vg0208214479 A -> G LOC_Os02g14800.2 intron_variant ; MODIFIER silent_mutation Average:41.455; most accessible tissue: Callus, score: 74.451 N N N N
vg0208214479 A -> G LOC_Os02g14800.3 intron_variant ; MODIFIER silent_mutation Average:41.455; most accessible tissue: Callus, score: 74.451 N N N N
vg0208214479 A -> DEL N N silent_mutation Average:41.455; most accessible tissue: Callus, score: 74.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208214479 NA 6.93E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 7.40E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 4.64E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 5.33E-13 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 1.10E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 6.31E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 8.99E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 7.18E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 8.93E-06 1.76E-27 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 5.05E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 1.79E-08 mr1565 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 1.17E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 1.46E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 2.77E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 1.02E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208214479 NA 3.24E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251