\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208206592:

Variant ID: vg0208206592 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8206592
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTAGAAGTAAATTAGATTTAGGCTGTGTCTAGTTCACACCAAAATTGAAAGTTTGGTTGAAATTAGAACGATGTGATGGAAAAGTTGAAAGTTTATGT[A/G]
TGTAGGAAAGTTTTGATGTGATGGAAAAGTGGAAGTTTTTTAAAAAAGTTTGGTACTAAACAAGGTGTTAGCATACAACTCATAATTCTATTCTTACATA

Reverse complement sequence

TATGTAAGAATAGAATTATGAGTTGTATGCTAACACCTTGTTTAGTACCAAACTTTTTTAAAAAACTTCCACTTTTCCATCACATCAAAACTTTCCTACA[T/C]
ACATAAACTTTCAACTTTTCCATCACATCGTTCTAATTTCAACCAAACTTTCAATTTTGGTGTGAACTAGACACAGCCTAAATCTAATTTACTTCTACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.60% 0.15% 0.00% NA
All Indica  2759 74.10% 25.70% 0.18% 0.00% NA
All Japonica  1512 70.40% 29.50% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 69.70% 30.10% 0.17% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 69.10% 30.80% 0.11% 0.00% NA
Indica Intermediate  786 75.60% 24.00% 0.38% 0.00% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 30.20% 69.40% 0.40% 0.00% NA
Japonica Intermediate  241 72.20% 27.80% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208206592 A -> G LOC_Os02g14790.1 upstream_gene_variant ; 199.0bp to feature; MODIFIER silent_mutation Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N
vg0208206592 A -> G LOC_Os02g14800.1 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N
vg0208206592 A -> G LOC_Os02g14800.4 upstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N
vg0208206592 A -> G LOC_Os02g14800.5 upstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N
vg0208206592 A -> G LOC_Os02g14800.2 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N
vg0208206592 A -> G LOC_Os02g14800.3 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N
vg0208206592 A -> G LOC_Os02g14790-LOC_Os02g14800 intergenic_region ; MODIFIER silent_mutation Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208206592 NA 4.36E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592 NA 9.15E-06 mr1448 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592 NA 7.97E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592 NA 9.52E-07 mr1701 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592 6.02E-06 6.01E-06 mr1703 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592 NA 2.09E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592 NA 1.41E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251