\
| Variant ID: vg0208206592 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8206592 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 81. )
GAGTAGAAGTAAATTAGATTTAGGCTGTGTCTAGTTCACACCAAAATTGAAAGTTTGGTTGAAATTAGAACGATGTGATGGAAAAGTTGAAAGTTTATGT[A/G]
TGTAGGAAAGTTTTGATGTGATGGAAAAGTGGAAGTTTTTTAAAAAAGTTTGGTACTAAACAAGGTGTTAGCATACAACTCATAATTCTATTCTTACATA
TATGTAAGAATAGAATTATGAGTTGTATGCTAACACCTTGTTTAGTACCAAACTTTTTTAAAAAACTTCCACTTTTCCATCACATCAAAACTTTCCTACA[T/C]
ACATAAACTTTCAACTTTTCCATCACATCGTTCTAATTTCAACCAAACTTTCAATTTTGGTGTGAACTAGACACAGCCTAAATCTAATTTACTTCTACTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 25.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 74.10% | 25.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 70.40% | 29.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.70% | 30.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.10% | 30.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 75.60% | 24.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 30.20% | 69.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208206592 | A -> G | LOC_Os02g14790.1 | upstream_gene_variant ; 199.0bp to feature; MODIFIER | silent_mutation | Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0208206592 | A -> G | LOC_Os02g14800.1 | upstream_gene_variant ; 3004.0bp to feature; MODIFIER | silent_mutation | Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0208206592 | A -> G | LOC_Os02g14800.4 | upstream_gene_variant ; 3003.0bp to feature; MODIFIER | silent_mutation | Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0208206592 | A -> G | LOC_Os02g14800.5 | upstream_gene_variant ; 3003.0bp to feature; MODIFIER | silent_mutation | Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0208206592 | A -> G | LOC_Os02g14800.2 | upstream_gene_variant ; 3004.0bp to feature; MODIFIER | silent_mutation | Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0208206592 | A -> G | LOC_Os02g14800.3 | upstream_gene_variant ; 3004.0bp to feature; MODIFIER | silent_mutation | Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0208206592 | A -> G | LOC_Os02g14790-LOC_Os02g14800 | intergenic_region ; MODIFIER | silent_mutation | Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208206592 | NA | 4.36E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208206592 | NA | 9.15E-06 | mr1448 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208206592 | NA | 7.97E-07 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208206592 | NA | 9.52E-07 | mr1701 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208206592 | 6.02E-06 | 6.01E-06 | mr1703 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208206592 | NA | 2.09E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208206592 | NA | 1.41E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |