Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0208200668:

Variant ID: vg0208200668 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8200668
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.30, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATATGTATTATATATATTATTATTATTCAGAAAAATAAGAGTTTTGAGTGATGCTTGCGCTGCTTTGTTCATGCTTTCATAAATTCGACAGGGCCACATA[G/A]
CTTGCATACTCTAATCCCACAAATACATATTGTTTCGAACATTAGCATTGAACTTACAGGACTTGAAAGTATTGTTGGCGAATCTGTACTTTTTCTCCAT

Reverse complement sequence

ATGGAGAAAAAGTACAGATTCGCCAACAATACTTTCAAGTCCTGTAAGTTCAATGCTAATGTTCGAAACAATATGTATTTGTGGGATTAGAGTATGCAAG[C/T]
TATGTGGCCCTGTCGAATTTATGAAAGCATGAACAAAGCAGCGCAAGCATCACTCAAAACTCTTATTTTTCTGAATAATAATAATATATATAATACATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	26.60%	0.25%	0.00%	NA
All Indica	2759	72.80%	26.90%	0.33%	0.00%	NA
All Japonica	1512	69.80%	30.10%	0.13%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	68.20%	31.60%	0.17%	0.00%	NA
Indica II	465	86.70%	13.10%	0.22%	0.00%	NA
Indica III	913	67.70%	32.00%	0.33%	0.00%	NA
Indica Intermediate	786	73.90%	25.60%	0.51%	0.00%	NA
Temperate Japonica	767	96.20%	3.80%	0.00%	0.00%	NA
Tropical Japonica	504	28.60%	71.20%	0.20%	0.00%	NA
Japonica Intermediate	241	71.80%	27.80%	0.41%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208200668	G -> A	LOC_Os02g14780.1	downstream_gene_variant ; 856.0bp to feature; MODIFIER	silent_mutation	Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0208200668	G -> A	LOC_Os02g14790.1	downstream_gene_variant ; 4300.0bp to feature; MODIFIER	silent_mutation	Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0208200668	G -> A	LOC_Os02g14780.2	downstream_gene_variant ; 280.0bp to feature; MODIFIER	silent_mutation	Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0208200668	G -> A	LOC_Os02g14780-LOC_Os02g14790	intergenic_region ; MODIFIER	silent_mutation	Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208200668	6.04E-06	NA	mr1188	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668	NA	4.86E-06	mr1448	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668	NA	3.21E-07	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668	NA	1.12E-06	mr1701	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668	NA	2.64E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668	NA	2.44E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668	NA	4.91E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251