\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208200668:

Variant ID: vg0208200668 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8200668
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.30, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGTATTATATATATTATTATTATTCAGAAAAATAAGAGTTTTGAGTGATGCTTGCGCTGCTTTGTTCATGCTTTCATAAATTCGACAGGGCCACATA[G/A]
CTTGCATACTCTAATCCCACAAATACATATTGTTTCGAACATTAGCATTGAACTTACAGGACTTGAAAGTATTGTTGGCGAATCTGTACTTTTTCTCCAT

Reverse complement sequence

ATGGAGAAAAAGTACAGATTCGCCAACAATACTTTCAAGTCCTGTAAGTTCAATGCTAATGTTCGAAACAATATGTATTTGTGGGATTAGAGTATGCAAG[C/T]
TATGTGGCCCTGTCGAATTTATGAAAGCATGAACAAAGCAGCGCAAGCATCACTCAAAACTCTTATTTTTCTGAATAATAATAATATATATAATACATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.60% 0.25% 0.00% NA
All Indica  2759 72.80% 26.90% 0.33% 0.00% NA
All Japonica  1512 69.80% 30.10% 0.13% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 68.20% 31.60% 0.17% 0.00% NA
Indica II  465 86.70% 13.10% 0.22% 0.00% NA
Indica III  913 67.70% 32.00% 0.33% 0.00% NA
Indica Intermediate  786 73.90% 25.60% 0.51% 0.00% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 28.60% 71.20% 0.20% 0.00% NA
Japonica Intermediate  241 71.80% 27.80% 0.41% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208200668 G -> A LOC_Os02g14780.1 downstream_gene_variant ; 856.0bp to feature; MODIFIER silent_mutation Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N
vg0208200668 G -> A LOC_Os02g14790.1 downstream_gene_variant ; 4300.0bp to feature; MODIFIER silent_mutation Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N
vg0208200668 G -> A LOC_Os02g14780.2 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N
vg0208200668 G -> A LOC_Os02g14780-LOC_Os02g14790 intergenic_region ; MODIFIER silent_mutation Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208200668 6.04E-06 NA mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668 NA 4.86E-06 mr1448 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668 NA 3.21E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668 NA 1.12E-06 mr1701 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668 NA 2.64E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668 NA 2.44E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200668 NA 4.91E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251