| Variant ID: vg0208200668 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8200668 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.30, others allele: 0.00, population size: 82. )
ATATGTATTATATATATTATTATTATTCAGAAAAATAAGAGTTTTGAGTGATGCTTGCGCTGCTTTGTTCATGCTTTCATAAATTCGACAGGGCCACATA[G/A]
CTTGCATACTCTAATCCCACAAATACATATTGTTTCGAACATTAGCATTGAACTTACAGGACTTGAAAGTATTGTTGGCGAATCTGTACTTTTTCTCCAT
ATGGAGAAAAAGTACAGATTCGCCAACAATACTTTCAAGTCCTGTAAGTTCAATGCTAATGTTCGAAACAATATGTATTTGTGGGATTAGAGTATGCAAG[C/T]
TATGTGGCCCTGTCGAATTTATGAAAGCATGAACAAAGCAGCGCAAGCATCACTCAAAACTCTTATTTTTCTGAATAATAATAATATATATAATACATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.20% | 26.60% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 72.80% | 26.90% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 69.80% | 30.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.20% | 31.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 67.70% | 32.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 73.90% | 25.60% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 71.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 27.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208200668 | G -> A | LOC_Os02g14780.1 | downstream_gene_variant ; 856.0bp to feature; MODIFIER | silent_mutation | Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 | N | N | N | N |
| vg0208200668 | G -> A | LOC_Os02g14790.1 | downstream_gene_variant ; 4300.0bp to feature; MODIFIER | silent_mutation | Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 | N | N | N | N |
| vg0208200668 | G -> A | LOC_Os02g14780.2 | downstream_gene_variant ; 280.0bp to feature; MODIFIER | silent_mutation | Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 | N | N | N | N |
| vg0208200668 | G -> A | LOC_Os02g14780-LOC_Os02g14790 | intergenic_region ; MODIFIER | silent_mutation | Average:63.94; most accessible tissue: Minghui63 flag leaf, score: 76.453 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208200668 | 6.04E-06 | NA | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208200668 | NA | 4.86E-06 | mr1448 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208200668 | NA | 3.21E-07 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208200668 | NA | 1.12E-06 | mr1701 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208200668 | NA | 2.64E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208200668 | NA | 2.44E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208200668 | NA | 4.91E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |