| Variant ID: vg0208199705 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8199705 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 200. )
GCTATAAAGGAGAATATTTTTGTTGGTTGCTGCCTATTAATTTCTGTATTCTCATGTTATGTTTAAACGTGGTGAAACACTGTTATTTGCACTATTTGAA[T/C]
GTCAGACATACATATCTCTTTATGGCCATCTGTTACTTAAAATATATGTTTTAGCTTCTGCTGTTTTGCTGTTGTGAAATGTGCTTGTCTTGAAAGTTCA
TGAACTTTCAAGACAAGCACATTTCACAACAGCAAAACAGCAGAAGCTAAAACATATATTTTAAGTAACAGATGGCCATAAAGAGATATGTATGTCTGAC[A/G]
TTCAAATAGTGCAAATAACAGTGTTTCACCACGTTTAAACATAACATGAGAATACAGAAATTAATAGGCAGCAACCAACAAAAATATTCTCCTTTATAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 26.50% | 0.06% | 0.28% | NA |
| All Indica | 2759 | 72.70% | 26.90% | 0.07% | 0.36% | NA |
| All Japonica | 1512 | 69.80% | 30.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.10% | 31.60% | 0.00% | 0.34% | NA |
| Indica II | 465 | 86.70% | 13.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 67.70% | 32.00% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 73.80% | 25.40% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.80% | 71.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 71.80% | 27.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208199705 | T -> DEL | N | N | silent_mutation | Average:57.439; most accessible tissue: Callus, score: 85.441 | N | N | N | N |
| vg0208199705 | T -> C | LOC_Os02g14780.1 | 3_prime_UTR_variant ; 154.0bp to feature; MODIFIER | silent_mutation | Average:57.439; most accessible tissue: Callus, score: 85.441 | N | N | N | N |
| vg0208199705 | T -> C | LOC_Os02g14780.2 | intron_variant ; MODIFIER | silent_mutation | Average:57.439; most accessible tissue: Callus, score: 85.441 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208199705 | NA | 1.55E-07 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208199705 | NA | 8.63E-06 | mr1701 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208199705 | 8.96E-06 | 8.95E-06 | mr1703 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208199705 | NA | 2.41E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208199705 | NA | 5.88E-08 | mr1350_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208199705 | NA | 1.22E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |