\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208170112:

Variant ID: vg0208170112 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8170112
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGCATCGCATTGTCAAAACATGGAGTAATTAGGCTTAAAATATTCGTCTCGCAAATTAGTCGCAATGCGATTAGTTATTTTTTAACTTATATTTAATA[C/T]
TTCATGCGATTAGTTTAATGTGACAGTGTAAAAAATTTTAAGGTGAGATTTAAACAGGGGCTAAAAGTTTTCTTTTTCAAATCTGAAAACGAAATGACTC

Reverse complement sequence

GAGTCATTTCGTTTTCAGATTTGAAAAAGAAAACTTTTAGCCCCTGTTTAAATCTCACCTTAAAATTTTTTACACTGTCACATTAAACTAATCGCATGAA[G/A]
TATTAAATATAAGTTAAAAAATAACTAATCGCATTGCGACTAATTTGCGAGACGAATATTTTAAGCCTAATTACTCCATGTTTTGACAATGCGATGCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 2.30% 2.41% 26.11% NA
All Indica  2759 65.70% 3.90% 3.81% 26.57% NA
All Japonica  1512 69.80% 0.00% 0.60% 29.56% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 57.00% 6.20% 5.88% 30.92% NA
Indica II  465 72.00% 7.10% 6.88% 13.98% NA
Indica III  913 66.90% 0.10% 0.99% 31.98% NA
Indica Intermediate  786 67.30% 4.60% 3.69% 24.43% NA
Temperate Japonica  767 95.80% 0.00% 0.13% 4.04% NA
Tropical Japonica  504 29.40% 0.00% 0.99% 69.64% NA
Japonica Intermediate  241 71.80% 0.00% 1.24% 26.97% NA
VI/Aromatic  96 59.40% 0.00% 0.00% 40.62% NA
Intermediate  90 84.40% 1.10% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208170112 C -> T LOC_Os02g14760.1 downstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:76.112; most accessible tissue: Minghui63 flower, score: 95.985 N N N N
vg0208170112 C -> T LOC_Os02g14770.1 downstream_gene_variant ; 2307.0bp to feature; MODIFIER silent_mutation Average:76.112; most accessible tissue: Minghui63 flower, score: 95.985 N N N N
vg0208170112 C -> T LOC_Os02g14760.2 downstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:76.112; most accessible tissue: Minghui63 flower, score: 95.985 N N N N
vg0208170112 C -> T LOC_Os02g14760-LOC_Os02g14770 intergenic_region ; MODIFIER silent_mutation Average:76.112; most accessible tissue: Minghui63 flower, score: 95.985 N N N N
vg0208170112 C -> DEL N N silent_mutation Average:76.112; most accessible tissue: Minghui63 flower, score: 95.985 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208170112 C T 0.01 0.01 0.01 -0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208170112 NA 4.96E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208170112 NA 9.82E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208170112 NA 7.21E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208170112 3.39E-06 1.04E-06 mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208170112 NA 1.27E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208170112 6.79E-06 1.14E-07 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208170112 NA 1.39E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208170112 NA 3.08E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251