\
| Variant ID: vg0208168116 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8168116 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )
TGGGGTCTCAGGCTCATCACATTGTTTTTTAGATTATTTTTTTCAAAAAAGAACTAATCATATGATTTTCTTTTCCCTGTGGTACAGTAATATTGACCTG[C/A]
GACTGAGTTTGTGTATGTTCTATTCTCCAAGAGTCAAGCTGCTTAACATAATTGTCTTCCTAACTGTGCAGGTTACAGAAGAAGATGTAAAGATTTTCTT
AAGAAAATCTTTACATCTTCTTCTGTAACCTGCACAGTTAGGAAGACAATTATGTTAAGCAGCTTGACTCTTGGAGAATAGAACATACACAAACTCAGTC[G/T]
CAGGTCAATATTACTGTACCACAGGGAAAAGAAAATCATATGATTAGTTCTTTTTTGAAAAAAATAATCTAAAAAACAATGTGATGAGCCTGAGACCCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 16.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 72.70% | 27.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 44.70% | 55.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208168116 | C -> A | LOC_Os02g14770.1 | downstream_gene_variant ; 4303.0bp to feature; MODIFIER | silent_mutation | Average:72.406; most accessible tissue: Minghui63 flag leaf, score: 83.621 | N | N | N | N |
| vg0208168116 | C -> A | LOC_Os02g14760.1 | intron_variant ; MODIFIER | silent_mutation | Average:72.406; most accessible tissue: Minghui63 flag leaf, score: 83.621 | N | N | N | N |
| vg0208168116 | C -> A | LOC_Os02g14760.2 | intron_variant ; MODIFIER | silent_mutation | Average:72.406; most accessible tissue: Minghui63 flag leaf, score: 83.621 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208168116 | NA | 4.71E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 3.81E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 4.71E-06 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 2.58E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 4.19E-13 | mr1557 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 1.60E-10 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 2.98E-08 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 2.68E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 1.08E-07 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208168116 | NA | 9.03E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |