Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208159232:

Variant ID: vg0208159232 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8159232
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.48, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCCTGAAGTCAATATCCGGCGGCGTGTCTTGACGTATGTAGGCTTCTATGTTGTGGCTTCTATGTCGATTGTGTTGGGTGTTGATCCTCCTCCCTCTC[T/C]
TCCTAAGGGGCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGAGAAACCAATATGAATACAATCCGAGTAGTCCTTGTCGTTTCTAT

Reverse complement sequence

ATAGAAACGACAAGGACTACTCGGATTGTATTCATATTGGTTTCTCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGCCCCTTAGGA[A/G]
GAGAGGGAGGAGGATCAACACCCAACACAATCGACATAGAAGCCACAACATAGAAGCCTACATACGTCAAGACACGCCGCCGGATATTGACTTCAGGGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	49.90%	0.17%	0.00%	NA
All Indica	2759	71.40%	28.40%	0.22%	0.00%	NA
All Japonica	1512	2.00%	97.90%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	66.70%	33.10%	0.17%	0.00%	NA
Indica II	465	86.50%	13.50%	0.00%	0.00%	NA
Indica III	913	66.20%	33.70%	0.11%	0.00%	NA
Indica Intermediate	786	72.00%	27.50%	0.51%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	2.20%	97.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	96.70%	0.41%	0.00%	NA
VI/Aromatic	96	56.20%	43.80%	0.00%	0.00%	NA
Intermediate	90	46.70%	52.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208159232	T -> C	LOC_Os02g14750.1	upstream_gene_variant ; 516.0bp to feature; MODIFIER	silent_mutation	Average:54.516; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0208159232	T -> C	LOC_Os02g14750-LOC_Os02g14760	intergenic_region ; MODIFIER	silent_mutation	Average:54.516; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208159232	NA	2.61E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	8.97E-06	6.09E-07	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	3.90E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	3.97E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	4.40E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	4.24E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	1.32E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	1.27E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	5.00E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	1.89E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	7.11E-06	mr1401	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	6.88E-06	mr1416	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	8.59E-07	mr1448	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	2.97E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	4.02E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	5.64E-07	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	8.08E-24	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	2.71E-07	NA	mr1559	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	4.26E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	9.48E-14	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	4.12E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	1.13E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	1.15E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	1.71E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	7.04E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	2.15E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	2.48E-06	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208159232	NA	1.16E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251