\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208157049:

Variant ID: vg0208157049 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8157049
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAAGTTCCCTTAGGTTTCTCGGAGGCATTGTCAAGACGGCGTAAAGGGACATTAGGATAGGTTTCAACGCTAGGTGTCTTTTGTGGTAAGGGATCTCT[A/G]
GGTAAAACACTTGGCGATATTGTGTCTCTCGATCATTTGGAGTCGTGGTACGAGGACCGCTACGCTGCCGGTCGAAGACTAGTCGTAGCTGTTCCTCAAC

Reverse complement sequence

GTTGAGGAACAGCTACGACTAGTCTTCGACCGGCAGCGTAGCGGTCCTCGTACCACGACTCCAAATGATCGAGAGACACAATATCGCCAAGTGTTTTACC[T/C]
AGAGATCCCTTACCACAAAAGACACCTAGCGTTGAAACCTATCCTAATGTCCCTTTACGCCGTCTTGACAATGCCTCCGAGAAACCTAAGGGAACTTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.60% 0.02% 0.00% NA
All Indica  2759 71.90% 28.10% 0.00% 0.00% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 67.10% 32.90% 0.00% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 66.40% 33.60% 0.00% 0.00% NA
Indica Intermediate  786 73.00% 27.00% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208157049 A -> G LOC_Os02g14750.1 downstream_gene_variant ; 550.0bp to feature; MODIFIER silent_mutation Average:39.122; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg0208157049 A -> G LOC_Os02g14740-LOC_Os02g14750 intergenic_region ; MODIFIER silent_mutation Average:39.122; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208157049 1.45E-06 2.39E-07 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 8.80E-06 mr1171 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 1.78E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 4.46E-12 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 8.77E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 4.17E-06 mr1416 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 1.70E-06 3.33E-08 mr1448 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 3.37E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 5.40E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 8.94E-07 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 3.20E-24 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 6.05E-07 NA mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 2.56E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 1.04E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 1.31E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 3.84E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 3.64E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 4.01E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049 NA 2.06E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251