Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208157049:

Variant ID: vg0208157049 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8157049
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCGAAGTTCCCTTAGGTTTCTCGGAGGCATTGTCAAGACGGCGTAAAGGGACATTAGGATAGGTTTCAACGCTAGGTGTCTTTTGTGGTAAGGGATCTCT[A/G]
GGTAAAACACTTGGCGATATTGTGTCTCTCGATCATTTGGAGTCGTGGTACGAGGACCGCTACGCTGCCGGTCGAAGACTAGTCGTAGCTGTTCCTCAAC

Reverse complement sequence

GTTGAGGAACAGCTACGACTAGTCTTCGACCGGCAGCGTAGCGGTCCTCGTACCACGACTCCAAATGATCGAGAGACACAATATCGCCAAGTGTTTTACC[T/C]
AGAGATCCCTTACCACAAAAGACACCTAGCGTTGAAACCTATCCTAATGTCCCTTTACGCCGTCTTGACAATGCCTCCGAGAAACCTAAGGGAACTTCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	49.60%	0.02%	0.00%	NA
All Indica	2759	71.90%	28.10%	0.00%	0.00%	NA
All Japonica	1512	2.10%	97.90%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	67.10%	32.90%	0.00%	0.00%	NA
Indica II	465	87.10%	12.90%	0.00%	0.00%	NA
Indica III	913	66.40%	33.60%	0.00%	0.00%	NA
Indica Intermediate	786	73.00%	27.00%	0.00%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	2.20%	97.80%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	56.20%	43.80%	0.00%	0.00%	NA
Intermediate	90	52.20%	46.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208157049	A -> G	LOC_Os02g14750.1	downstream_gene_variant ; 550.0bp to feature; MODIFIER	silent_mutation	Average:39.122; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg0208157049	A -> G	LOC_Os02g14740-LOC_Os02g14750	intergenic_region ; MODIFIER	silent_mutation	Average:39.122; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208157049	1.45E-06	2.39E-07	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	8.80E-06	mr1171	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	1.78E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	4.46E-12	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	8.77E-06	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	4.17E-06	mr1416	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	1.70E-06	3.33E-08	mr1448	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	3.37E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	5.40E-07	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	8.94E-07	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	3.20E-24	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	6.05E-07	NA	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	2.56E-14	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	1.04E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	1.31E-13	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	3.84E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	3.64E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	4.01E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208157049	NA	2.06E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251