\
| Variant ID: vg0208155990 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8155990 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.01, others allele: 0.00, population size: 259. )
GTCAAGTAGAACTAGGGAAACTAATATGGATACAATCTGAGTAGTTCTTGTCGTTTCCATGTAGAACTCTGGTTGTCTTTCCTTATCCGAAACTCCTCCT[A/C]
TATCCGAAGGTTGCTTCCGTATAGGACATGGTATGTAGTGGGTCCTGCCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCATGACAGTA
TACTGTCATGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGGCAGGACCCACTACATACCATGTCCTATACGGAAGCAACCTTCGGATA[T/G]
AGGAGGAGTTTCGGATAAGGAAAGACAACCAGAGTTCTACATGGAAACGACAAGAACTACTCAGATTGTATCCATATTAGTTTCCCTAGTTCTACTTGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 13.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 88.70% | 11.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208155990 | A -> C | LOC_Os02g14740.1 | upstream_gene_variant ; 4023.0bp to feature; MODIFIER | silent_mutation | Average:49.868; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0208155990 | A -> C | LOC_Os02g14750.1 | downstream_gene_variant ; 1609.0bp to feature; MODIFIER | silent_mutation | Average:49.868; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0208155990 | A -> C | LOC_Os02g14740-LOC_Os02g14750 | intergenic_region ; MODIFIER | silent_mutation | Average:49.868; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208155990 | 1.90E-07 | 1.47E-06 | mr1401 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208155990 | NA | 2.41E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208155990 | NA | 4.13E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208155990 | 7.57E-06 | 7.57E-06 | mr1762 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208155990 | NA | 1.31E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208155990 | NA | 2.27E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |