\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208155990:

Variant ID: vg0208155990 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8155990
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAAGTAGAACTAGGGAAACTAATATGGATACAATCTGAGTAGTTCTTGTCGTTTCCATGTAGAACTCTGGTTGTCTTTCCTTATCCGAAACTCCTCCT[A/C]
TATCCGAAGGTTGCTTCCGTATAGGACATGGTATGTAGTGGGTCCTGCCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCATGACAGTA

Reverse complement sequence

TACTGTCATGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGGCAGGACCCACTACATACCATGTCCTATACGGAAGCAACCTTCGGATA[T/G]
AGGAGGAGTTTCGGATAAGGAAAGACAACCAGAGTTCTACATGGAAACGACAAGAACTACTCAGATTGTATCCATATTAGTTTCCCTAGTTCTACTTGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 13.10% 0.02% 0.00% NA
All Indica  2759 88.70% 11.30% 0.04% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.17% 0.00% NA
Indica II  465 74.40% 25.60% 0.00% 0.00% NA
Indica III  913 92.10% 7.90% 0.00% 0.00% NA
Indica Intermediate  786 88.70% 11.30% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208155990 A -> C LOC_Os02g14740.1 upstream_gene_variant ; 4023.0bp to feature; MODIFIER silent_mutation Average:49.868; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0208155990 A -> C LOC_Os02g14750.1 downstream_gene_variant ; 1609.0bp to feature; MODIFIER silent_mutation Average:49.868; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0208155990 A -> C LOC_Os02g14740-LOC_Os02g14750 intergenic_region ; MODIFIER silent_mutation Average:49.868; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208155990 1.90E-07 1.47E-06 mr1401 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208155990 NA 2.41E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208155990 NA 4.13E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208155990 7.57E-06 7.57E-06 mr1762 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208155990 NA 1.31E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208155990 NA 2.27E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251