\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208153831:

Variant ID: vg0208153831 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8153831
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TATCGGCTTCGGCCAACAGGATGTAGTGTTATTACCTAACAATTCAGGGGCCCGAACCTGTATAAAAATCCCTGTCTCGATCTCTTTTACCTCAGTCTCG[C/T]
GTATACCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAACCGCGACATCAAACGTCGACAGTTTCAATCTTGTAAAAAGCTAAAACATAATCAA

Reverse complement sequence

TTGATTATGTTTTAGCTTTTTACAAGATTGAAACTGTCGACGTTTGATGTCGCGGTTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGGTATAC[G/A]
CGAGACTGAGGTAAAAGAGATCGAGACAGGGATTTTTATACAGGTTCGGGCCCCTGAATTGTTAGGTAATAACACTACATCCTGTTGGCCGAAGCCGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 27.30% 0.00% 0.00% NA
All Indica  2759 66.70% 33.30% 0.00% 0.00% NA
All Japonica  1512 98.40% 1.60% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 87.70% 12.30% 0.00% 0.00% NA
Indica II  465 37.00% 63.00% 0.00% 0.00% NA
Indica III  913 69.90% 30.10% 0.00% 0.00% NA
Indica Intermediate  786 64.50% 35.50% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208153831 C -> T LOC_Os02g14740.1 upstream_gene_variant ; 1864.0bp to feature; MODIFIER silent_mutation Average:37.359; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0208153831 C -> T LOC_Os02g14750.1 downstream_gene_variant ; 3768.0bp to feature; MODIFIER silent_mutation Average:37.359; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0208153831 C -> T LOC_Os02g14740-LOC_Os02g14750 intergenic_region ; MODIFIER silent_mutation Average:37.359; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208153831 NA 2.39E-15 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 1.96E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 1.57E-13 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 2.35E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 5.81E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 6.28E-06 1.59E-31 mr1557 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 2.47E-11 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 1.20E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 8.04E-08 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 5.91E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 7.05E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 2.24E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 1.39E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 8.10E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 8.39E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208153831 NA 2.84E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251