\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208128713:

Variant ID: vg0208128713 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 8128713
Reference Allele: TAlternative Allele: C,TCC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.46, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGGTTGTGTGTATAGATCTAAAGTTTGGATCCAAACTTCAGTCATTTTCCAACACATTAACCTGTCATATAAACATAACTTTTCAGTCACATCATCTT[T/C,TCC]
AATTTTAACCAAAATCCAAACTTTGCGCTGACTAAACACAGACAGCCATAGTTTAAAATTGAGGTAAAATTGTTTTGATGTCCTGAGATATTTCTTGATA

Reverse complement sequence

TATCAAGAAATATCTCAGGACATCAAAACAATTTTACCTCAATTTTAAACTATGGCTGTCTGTGTTTAGTCAGCGCAAAGTTTGGATTTTGGTTAAAATT[A/G,GGA]
AAGATGATGTGACTGAAAAGTTATGTTTATATGACAGGTTAATGTGTTGGAAAATGACTGAAGTTTGGATCCAAACTTTAGATCTATACACACAACCTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 14.20% 3.64% 26.20% TCC: 0.02%
All Indica  2759 57.40% 5.40% 5.44% 31.79% TCC: 0.04%
All Japonica  1512 65.50% 31.70% 1.19% 1.59% NA
Aus  269 1.50% 0.00% 0.00% 98.51% NA
Indica I  595 87.10% 1.50% 5.88% 5.55% NA
Indica II  465 31.60% 3.40% 8.60% 56.34% NA
Indica III  913 50.70% 8.70% 1.42% 39.21% NA
Indica Intermediate  786 57.90% 5.60% 7.89% 28.50% TCC: 0.13%
Temperate Japonica  767 89.20% 9.00% 1.17% 0.65% NA
Tropical Japonica  504 24.60% 72.20% 0.99% 2.18% NA
Japonica Intermediate  241 75.50% 19.50% 1.66% 3.32% NA
VI/Aromatic  96 22.90% 25.00% 0.00% 52.08% NA
Intermediate  90 52.20% 18.90% 4.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208128713 T -> TCC LOC_Os02g14720-LOC_Os02g14730 intergenic_region ; MODIFIER silent_mutation Average:81.347; most accessible tissue: Callus, score: 92.729 N N N N
vg0208128713 T -> DEL N N silent_mutation Average:81.347; most accessible tissue: Callus, score: 92.729 N N N N
vg0208128713 T -> C LOC_Os02g14720-LOC_Os02g14730 intergenic_region ; MODIFIER silent_mutation Average:81.347; most accessible tissue: Callus, score: 92.729 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208128713 1.98E-06 9.28E-07 mr1484 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 1.20E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 2.96E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 7.11E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 1.47E-11 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 3.84E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 3.22E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 3.17E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 6.02E-14 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208128713 NA 7.52E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251