| Variant ID: vg0208125954 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8125954 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 115. )
AACATCTTTTTTAATGGAGTGTCACTTTGTAAAATTTCTTTGGAGAGCTGTTCAGGTTTCATCTGGTTTATACCTTCCACATAGTATATGTCTTATATGC[A/T]
GGTTCTTTTCAGGGCAACATATTGACTACGGTCCTGGGCACAACTACAAAAGTATGATGAAGACTGCAAGCTTTTGAAGACTACATGTCGTAATCTTGAG
CTCAAGATTACGACATGTAGTCTTCAAAAGCTTGCAGTCTTCATCATACTTTTGTAGTTGTGCCCAGGACCGTAGTCAATATGTTGCCCTGAAAAGAACC[T/A]
GCATATAAGACATATACTATGTGGAAGGTATAAACCAGATGAAACCTGAACAGCTCTCCAAAGAAATTTTACAAAGTGACACTCCATTAAAAAAGATGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 43.50% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 39.20% | 60.60% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 44.90% | 54.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 43.20% | 56.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 34.50% | 65.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 37.90% | 61.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208125954 | A -> T | LOC_Os02g14720.1 | downstream_gene_variant ; 4029.0bp to feature; MODIFIER | silent_mutation | Average:58.195; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0208125954 | A -> T | LOC_Os02g14720.2 | downstream_gene_variant ; 4029.0bp to feature; MODIFIER | silent_mutation | Average:58.195; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0208125954 | A -> T | LOC_Os02g14720-LOC_Os02g14730 | intergenic_region ; MODIFIER | silent_mutation | Average:58.195; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208125954 | NA | 4.90E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208125954 | 6.45E-08 | 3.38E-11 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208125954 | NA | 1.43E-07 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208125954 | 1.63E-08 | 8.06E-09 | mr1570_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |