\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208125954:

Variant ID: vg0208125954 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8125954
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AACATCTTTTTTAATGGAGTGTCACTTTGTAAAATTTCTTTGGAGAGCTGTTCAGGTTTCATCTGGTTTATACCTTCCACATAGTATATGTCTTATATGC[A/T]
GGTTCTTTTCAGGGCAACATATTGACTACGGTCCTGGGCACAACTACAAAAGTATGATGAAGACTGCAAGCTTTTGAAGACTACATGTCGTAATCTTGAG

Reverse complement sequence

CTCAAGATTACGACATGTAGTCTTCAAAAGCTTGCAGTCTTCATCATACTTTTGTAGTTGTGCCCAGGACCGTAGTCAATATGTTGCCCTGAAAAGAACC[T/A]
GCATATAAGACATATACTATGTGGAAGGTATAAACCAGATGAAACCTGAACAGCTCTCCAAAGAAATTTTACAAAGTGACACTCCATTAAAAAAGATGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 43.50% 0.13% 0.00% NA
All Indica  2759 39.20% 60.60% 0.22% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 44.90% 54.80% 0.34% 0.00% NA
Indica II  465 43.20% 56.60% 0.22% 0.00% NA
Indica III  913 34.50% 65.40% 0.11% 0.00% NA
Indica Intermediate  786 37.90% 61.80% 0.25% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208125954 A -> T LOC_Os02g14720.1 downstream_gene_variant ; 4029.0bp to feature; MODIFIER silent_mutation Average:58.195; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0208125954 A -> T LOC_Os02g14720.2 downstream_gene_variant ; 4029.0bp to feature; MODIFIER silent_mutation Average:58.195; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0208125954 A -> T LOC_Os02g14720-LOC_Os02g14730 intergenic_region ; MODIFIER silent_mutation Average:58.195; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208125954 NA 4.90E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208125954 6.45E-08 3.38E-11 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208125954 NA 1.43E-07 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208125954 1.63E-08 8.06E-09 mr1570_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251