\
| Variant ID: vg0208050121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8050121 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAGAGTATACATATGCAGTTGTTTGGTTGGTTGCATTGGTCTAGCCAGGCTAGCATGAGATTTTGTTTGGTTACTTGTATAAGAGATACGGTTTGAAAG[G/A]
GATTTTGTTTGGTTGGTTGCATGGATGTGAGTGTTCTTTACCTCTTCATTTAGTTGGGTGAGGTTACCTCTACAATATATATAACAAATAATAAGAGTAT
ATACTCTTATTATTTGTTATATATATTGTAGAGGTAACCTCACCCAACTAAATGAAGAGGTAAAGAACACTCACATCCATGCAACCAACCAAACAAAATC[C/T]
CTTTCAAACCGTATCTCTTATACAAGTAACCAAACAAAATCTCATGCTAGCCTGGCTAGACCAATGCAACCAACCAAACAACTGCATATGTATACTCTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.30% | 3.70% | 0.99% | 1.02% | NA |
| All Indica | 2759 | 99.20% | 0.00% | 0.80% | 0.04% | NA |
| All Japonica | 1512 | 86.90% | 11.20% | 1.39% | 0.53% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.37% | 1.12% | NA |
| Indica I | 595 | 97.80% | 0.00% | 2.18% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.00% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 98.00% | 0.70% | 0.78% | 0.52% | NA |
| Tropical Japonica | 504 | 67.50% | 29.40% | 2.78% | 0.40% | NA |
| Japonica Intermediate | 241 | 92.10% | 6.60% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 71.90% | 0.00% | 0.00% | 28.12% | NA |
| Intermediate | 90 | 82.20% | 4.40% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208050121 | G -> A | LOC_Os02g14590.1 | upstream_gene_variant ; 1983.0bp to feature; MODIFIER | silent_mutation | Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0208050121 | G -> A | LOC_Os02g14580.1 | downstream_gene_variant ; 1995.0bp to feature; MODIFIER | silent_mutation | Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0208050121 | G -> A | LOC_Os02g14580-LOC_Os02g14590 | intergenic_region ; MODIFIER | silent_mutation | Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0208050121 | G -> DEL | N | N | silent_mutation | Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208050121 | 3.29E-06 | 6.48E-06 | mr1098_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208050121 | 7.08E-06 | NA | mr1150_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208050121 | NA | 7.10E-08 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208050121 | NA | 1.40E-07 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208050121 | NA | 4.18E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208050121 | 9.80E-06 | NA | mr1874_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208050121 | NA | 5.75E-10 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |