\
| Variant ID: vg0208025341 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8025341 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTTATCGGCAACGCTCTACAGCTCCGGATTTTCAAACGATACTTTTCCTTCATCCGTGATCTTCGGAGTTCTAGCTCTTACCCAGTTCCTTGATCTCT[G/A]
TGTCCACTCCTCCATTGGTACCGGTTGCCCCTTCTTCCTCATTTCCTCCTCCTCTTTAGTCCACTGCTCCACCATTGGTGCGTATCCCGCGGAGCCTAAG
CTTAGGCTCCGCGGGATACGCACCAATGGTGGAGCAGTGGACTAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACA[C/T]
AGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTATCGTTTGAAAATCCGGAGCTGTAGAGCGTTGCCGATAAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.30% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 69.60% | 29.20% | 1.19% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 1.60% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 27.60% | 70.20% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 31.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208025341 | G -> A | LOC_Os02g14550.1 | stop_gained ; p.Gln300*; HIGH | stop_gained | Average:30.651; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208025341 | NA | 1.00E-07 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 1.78E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 4.52E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | 4.49E-06 | NA | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 5.01E-09 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 1.10E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 3.42E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 1.39E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 3.71E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 1.90E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208025341 | NA | 3.79E-23 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |