Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208023522:

Variant ID: vg0208023522 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8023522
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTATGCACTGTATGGATGTCGTACCATTTCACAGTAAGGAGGATATTTATTTATAATACATTCATATACAAATGCAAGAGTCATAATAACTTACTACT[A/G]
TAAGATTGTTAGAAATTCTTTGTATTGCTTGTGACTGTAATCGAGAGGGTCCAAGACTACCACGGTTCCGTCTTTAGGGTGGATAAGTAAACAGATATAA

Reverse complement sequence

TTATATCTGTTTACTTATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACAGTCACAAGCAATACAAAGAATTTCTAACAATCTTA[T/C]
AGTAGTAAGTTATTATGACTCTTGCATTTGTATATGAATGTATTATAAATAAATATCCTCCTTACTGTGAAATGGTACGACATCCATACAGTGCATACCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	24.40%	20.04%	0.00%	NA
All Indica	2759	36.60%	34.20%	29.18%	0.00%	NA
All Japonica	1512	98.00%	1.70%	0.26%	0.00%	NA
Aus	269	14.90%	42.80%	42.38%	0.00%	NA
Indica I	595	35.80%	36.60%	27.56%	0.00%	NA
Indica II	465	21.70%	47.30%	30.97%	0.00%	NA
Indica III	913	47.40%	24.30%	28.26%	0.00%	NA
Indica Intermediate	786	33.60%	36.00%	30.41%	0.00%	NA
Temperate Japonica	767	98.30%	1.60%	0.13%	0.00%	NA
Tropical Japonica	504	98.00%	1.60%	0.40%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	43.80%	47.90%	8.33%	0.00%	NA
Intermediate	90	54.40%	27.80%	17.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208023522	A -> G	LOC_Os02g14540.1	upstream_gene_variant ; 4167.0bp to feature; MODIFIER	silent_mutation	Average:27.026; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N
vg0208023522	A -> G	LOC_Os02g14560.1	downstream_gene_variant ; 4331.0bp to feature; MODIFIER	silent_mutation	Average:27.026; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N
vg0208023522	A -> G	LOC_Os02g14550.1	intron_variant ; MODIFIER	silent_mutation	Average:27.026; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208023522	NA	1.75E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	7.14E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	3.11E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	1.36E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	8.55E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	1.79E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	6.03E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	4.84E-18	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	2.08E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	1.32E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	4.85E-06	NA	mr1944	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208023522	NA	5.21E-06	mr1944	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251