\
| Variant ID: vg0208023522 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8023522 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 49. )
TGGTATGCACTGTATGGATGTCGTACCATTTCACAGTAAGGAGGATATTTATTTATAATACATTCATATACAAATGCAAGAGTCATAATAACTTACTACT[A/G]
TAAGATTGTTAGAAATTCTTTGTATTGCTTGTGACTGTAATCGAGAGGGTCCAAGACTACCACGGTTCCGTCTTTAGGGTGGATAAGTAAACAGATATAA
TTATATCTGTTTACTTATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACAGTCACAAGCAATACAAAGAATTTCTAACAATCTTA[T/C]
AGTAGTAAGTTATTATGACTCTTGCATTTGTATATGAATGTATTATAAATAAATATCCTCCTTACTGTGAAATGGTACGACATCCATACAGTGCATACCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.50% | 24.40% | 20.04% | 0.00% | NA |
| All Indica | 2759 | 36.60% | 34.20% | 29.18% | 0.00% | NA |
| All Japonica | 1512 | 98.00% | 1.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 14.90% | 42.80% | 42.38% | 0.00% | NA |
| Indica I | 595 | 35.80% | 36.60% | 27.56% | 0.00% | NA |
| Indica II | 465 | 21.70% | 47.30% | 30.97% | 0.00% | NA |
| Indica III | 913 | 47.40% | 24.30% | 28.26% | 0.00% | NA |
| Indica Intermediate | 786 | 33.60% | 36.00% | 30.41% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 47.90% | 8.33% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 27.80% | 17.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208023522 | A -> G | LOC_Os02g14540.1 | upstream_gene_variant ; 4167.0bp to feature; MODIFIER | silent_mutation | Average:27.026; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0208023522 | A -> G | LOC_Os02g14560.1 | downstream_gene_variant ; 4331.0bp to feature; MODIFIER | silent_mutation | Average:27.026; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0208023522 | A -> G | LOC_Os02g14550.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.026; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208023522 | NA | 1.75E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 7.14E-11 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 3.11E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 1.36E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 8.55E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 1.79E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 6.03E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 4.84E-18 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 2.08E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 1.32E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | 4.85E-06 | NA | mr1944 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208023522 | NA | 5.21E-06 | mr1944 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |