\
| Variant ID: vg0208003316 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8003316 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGAACAATCGTCATAAACAGCCTCTGTTTATAACATATATGTGTTCTGTCATCAGGTAATCGTCACAGAAGCCCAGATTTGTTGTAGTGATCATCCCTC[A/G]
ACCATAAACAGGGTATAATGCATTCCCATCTTCGAAAGTTGCTGCAATTAGACTTCTTTGGTGGCTGAGAAAGTTGTTTTTTGTTGGCATGACCAGTTAA
TTAACTGGTCATGCCAACAAAAAACAACTTTCTCAGCCACCAAAGAAGTCTAATTGCAGCAACTTTCGAAGATGGGAATGCATTATACCCTGTTTATGGT[T/C]
GAGGGATGATCACTACAACAAATCTGGGCTTCTGTGACGATTACCTGATGACAGAACACATATATGTTATAAACAGAGGCTGTTTATGACGATTGTTCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 36.90% | 0.08% | 0.02% | NA |
| All Indica | 2759 | 38.50% | 61.30% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 98.30% | 1.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 32.60% | 67.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 19.60% | 80.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 53.00% | 47.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 37.40% | 62.30% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208003316 | A -> G | LOC_Os02g14520.1 | upstream_gene_variant ; 1437.0bp to feature; MODIFIER | silent_mutation | Average:72.005; most accessible tissue: Callus, score: 82.016 | N | N | N | N |
| vg0208003316 | A -> G | LOC_Os02g14530.1 | upstream_gene_variant ; 1665.0bp to feature; MODIFIER | silent_mutation | Average:72.005; most accessible tissue: Callus, score: 82.016 | N | N | N | N |
| vg0208003316 | A -> G | LOC_Os02g14520-LOC_Os02g14530 | intergenic_region ; MODIFIER | silent_mutation | Average:72.005; most accessible tissue: Callus, score: 82.016 | N | N | N | N |
| vg0208003316 | A -> DEL | N | N | silent_mutation | Average:72.005; most accessible tissue: Callus, score: 82.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208003316 | NA | 3.64E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208003316 | 1.06E-06 | 5.43E-07 | mr1416 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208003316 | NA | 5.29E-06 | mr1448 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208003316 | NA | 2.99E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208003316 | NA | 1.52E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |