\
| Variant ID: vg0207984549 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7984549 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 93. )
AGAGGTACTATATTTTATCGTGTAAAATTTGGTATCTCTCAGTACCTGTTATACTAGAAGCTAGGTAATTTGTACTAGAAATTGGTACCTCTTGGTACAC[T/C]
GTAAAATTTAATTTCTCTTTACAGTAAGAAACGAGGAGGACCTATAGTTTGCCCGACCGCATCGGGATGCACTCATGTGTAATCCTTATCCATGGTTTCC
GGAAACCATGGATAAGGATTACACATGAGTGCATCCCGATGCGGTCGGGCAAACTATAGGTCCTCCTCGTTTCTTACTGTAAAGAGAAATTAAATTTTAC[A/G]
GTGTACCAAGAGGTACCAATTTCTAGTACAAATTACCTAGCTTCTAGTATAACAGGTACTGAGAGATACCAAATTTTACACGATAAAATATAGTACCTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 39.80% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 88.40% | 10.80% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.50% | 1.01% | 0.00% | NA |
| Indica II | 465 | 86.90% | 12.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 84.20% | 15.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 87.30% | 11.70% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 47.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207984549 | T -> C | LOC_Os02g14490.1 | upstream_gene_variant ; 1281.0bp to feature; MODIFIER | silent_mutation | Average:54.893; most accessible tissue: Callus, score: 88.57 | N | N | N | N |
| vg0207984549 | T -> C | LOC_Os02g14480-LOC_Os02g14490 | intergenic_region ; MODIFIER | silent_mutation | Average:54.893; most accessible tissue: Callus, score: 88.57 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207984549 | NA | 1.29E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207984549 | NA | 6.79E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207984549 | NA | 3.61E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207984549 | NA | 1.15E-08 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207984549 | NA | 6.87E-34 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207984549 | NA | 6.59E-19 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207984549 | 7.56E-08 | NA | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207984549 | NA | 2.36E-66 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |