\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207929583:

Variant ID: vg0207929583 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7929583
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTTTAGTTTGTTGCTAAATTTTGCCCTTTGATTTCTTGTCAAATTCTTGAGACCCTTGGAGGCTAGAATGTTCCTCTCAGTGATTGTAATCAGTATTT[C/T]
CATAGGACTATTGTAACATCCCACCCTTCAGAACCATGCAGCACAGCCCAACTGATAGGTGGGCCCATTTACACATACTACCCCACTTACACTTTCGTCC

Reverse complement sequence

GGACGAAAGTGTAAGTGGGGTAGTATGTGTAAATGGGCCCACCTATCAGTTGGGCTGTGCTGCATGGTTCTGAAGGGTGGGATGTTACAATAGTCCTATG[G/A]
AAATACTGATTACAATCACTGAGAGGAACATTCTAGCCTCCAAGGGTCTCAAGAATTTGACAAGAAATCAAAGGGCAAAATTTAGCAACAAACTAAACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 7.80% 0.38% 54.85% NA
All Indica  2759 7.20% 2.20% 0.51% 90.14% NA
All Japonica  1512 97.20% 0.30% 0.00% 2.51% NA
Aus  269 1.10% 87.40% 0.37% 11.15% NA
Indica I  595 3.70% 0.30% 0.34% 95.63% NA
Indica II  465 4.70% 1.30% 0.22% 93.76% NA
Indica III  913 9.90% 2.30% 0.33% 87.51% NA
Indica Intermediate  786 8.10% 3.90% 1.02% 86.90% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 95.80% 0.00% 0.00% 4.17% NA
Japonica Intermediate  241 96.70% 1.70% 0.00% 1.66% NA
VI/Aromatic  96 40.60% 58.30% 0.00% 1.04% NA
Intermediate  90 40.00% 16.70% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207929583 C -> T LOC_Os02g14420-LOC_Os02g14430 intergenic_region ; MODIFIER silent_mutation Average:10.382; most accessible tissue: Callus, score: 57.185 N N N N
vg0207929583 C -> DEL N N silent_mutation Average:10.382; most accessible tissue: Callus, score: 57.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207929583 NA 1.52E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 7.39E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 5.22E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 5.82E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 2.28E-06 NA mr1704 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 7.00E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 4.46E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 1.12E-08 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 5.13E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 2.08E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 4.74E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207929583 NA 4.14E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251