\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207917838:

Variant ID: vg0207917838 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7917838
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCTACTAACAGATGTTAGCCGATGGTAGGTTAGATGACGATATTACCGAAGATTATACAAGATATATGATAACTTGACGAATTACATAAACAAGATTA[G/C]
AGTGTCATAAAGATGGAAGCACTAATCCCGAAAACACAAGTCGCCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAG

Reverse complement sequence

CTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGGCGACTTGTGTTTTCGGGATTAGTGCTTCCATCTTTATGACACT[C/G]
TAATCTTGTTTATGTAATTCGTCAAGTTATCATATATCTTGTATAATCTTCGGTAATATCGTCATCTAACCTACCATCGGCTAACATCTGTTAGTAGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 1.60% 0.25% 1.23% NA
All Indica  2759 99.90% 0.00% 0.00% 0.14% NA
All Japonica  1512 94.60% 5.00% 0.40% 0.00% NA
Aus  269 81.80% 0.00% 1.12% 17.10% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 99.70% 0.00% 0.00% 0.25% NA
Temperate Japonica  767 90.90% 8.30% 0.78% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 0.00% 2.08% 8.33% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207917838 G -> DEL N N silent_mutation Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0207917838 G -> C LOC_Os02g14410.1 upstream_gene_variant ; 810.0bp to feature; MODIFIER silent_mutation Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0207917838 G -> C LOC_Os02g14420.1 upstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0207917838 G -> C LOC_Os02g14410-LOC_Os02g14420 intergenic_region ; MODIFIER silent_mutation Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207917838 5.67E-06 NA mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207917838 7.69E-07 1.72E-06 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207917838 8.81E-06 2.93E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207917838 6.10E-07 2.17E-06 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251