Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0207917838:

Variant ID: vg0207917838 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7917838
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCTACTAACAGATGTTAGCCGATGGTAGGTTAGATGACGATATTACCGAAGATTATACAAGATATATGATAACTTGACGAATTACATAAACAAGATTA[G/C]
AGTGTCATAAAGATGGAAGCACTAATCCCGAAAACACAAGTCGCCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAG

Reverse complement sequence

CTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGGCGACTTGTGTTTTCGGGATTAGTGCTTCCATCTTTATGACACT[C/G]
TAATCTTGTTTATGTAATTCGTCAAGTTATCATATATCTTGTATAATCTTCGGTAATATCGTCATCTAACCTACCATCGGCTAACATCTGTTAGTAGAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	1.60%	0.25%	1.23%	NA
All Indica	2759	99.90%	0.00%	0.00%	0.14%	NA
All Japonica	1512	94.60%	5.00%	0.40%	0.00%	NA
Aus	269	81.80%	0.00%	1.12%	17.10%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.80%	0.00%	0.00%	0.22%	NA
Indica Intermediate	786	99.70%	0.00%	0.00%	0.25%	NA
Temperate Japonica	767	90.90%	8.30%	0.78%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	0.00%	2.08%	8.33%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207917838	G -> DEL	N	N	silent_mutation	Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0207917838	G -> C	LOC_Os02g14410.1	upstream_gene_variant ; 810.0bp to feature; MODIFIER	silent_mutation	Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0207917838	G -> C	LOC_Os02g14420.1	upstream_gene_variant ; 4412.0bp to feature; MODIFIER	silent_mutation	Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N
vg0207917838	G -> C	LOC_Os02g14410-LOC_Os02g14420	intergenic_region ; MODIFIER	silent_mutation	Average:27.392; most accessible tissue: Zhenshan97 flag leaf, score: 60.705	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207917838	5.67E-06	NA	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207917838	7.69E-07	1.72E-06	mr1613_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207917838	8.81E-06	2.93E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207917838	6.10E-07	2.17E-06	mr1913_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251