Search for Variation information by Variation ID:
Detailed information for vg0207908595:
| Variant ID: vg0207908595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7908595 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CAAGAAAAGGAAAACCAGATCATCAGCTGTGGACACATCAGGTCCGGCTCTCAAGAAGAAAACCAAGTCAAAGAAAACCAAGCCAACTGATGATCTGCCT[G/A,T]
CCCTAGATCCATCTATCGAACAAGCGCTAGACGAGGAAGAGATTGAAGAGGACGTTGATCAAGCTGCAGCCGAAGTGAGCGATACAGAGAGAACACCATC
Reverse complement sequence
GATGGTGTTCTCTCTGTATCGCTCACTTCGGCTGCAGCTTGATCAACGTCCTCTTCAATCTCTTCCTCGTCTAGCGCTTGTTCGATAGATGGATCTAGGG[C/T,A]
AGGCAGATCATCAGTTGGCTTGGTTTTCTTTGACTTGGTTTTCTTCTTGAGAGCCGGACCTGATGTGTCCACAGCTGATGATCTGGTTTTCCTTTTCTTG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 1.70% | 3.13% | 1.31% | T: 0.02% |
| All Indica | 2759 | 93.00% | 3.00% | 3.73% | 0.29% | T: 0.04% |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 71.00% | 0.00% | 14.13% | 14.87% | NA |
| Indica I | 595 | 82.50% | 5.90% | 11.60% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 97.50% | 1.50% | 0.66% | 0.33% | NA |
| Indica Intermediate | 786 | 91.90% | 4.20% | 3.18% | 0.64% | T: 0.13% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 4.17% | 10.42% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 2.22% | 4.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207908595 | G -> A | LOC_Os02g14400.1 | missense_variant ; p.Ala72Thr; MODERATE | nonsynonymous_codon ; A72T | Average:28.555; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | benign  |
0.303 |
TOLERATED | 0.28 |
| vg0207908595 | G -> T | LOC_Os02g14400.1 | missense_variant ; p.Ala72Ser; MODERATE | nonsynonymous_codon ; A72S | Average:28.555; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | benign |
0.549 |
DELETERIOUS | 0.02 |
| vg0207908595 | G -> DEL | LOC_Os02g14400.1 | N | frameshift_variant | Average:28.555; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207908595 | NA | 3.16E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | 2.76E-07 | 2.76E-07 | mr1344_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | 4.82E-06 | 1.91E-06 | mr1351_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | 1.78E-06 | 1.78E-06 | mr1357_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | NA | 1.90E-06 | mr1381_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | 2.92E-08 | 2.92E-08 | mr1464_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | NA | 2.43E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | 7.64E-08 | 7.64E-08 | mr1512_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | 2.33E-06 | 2.33E-06 | mr1569_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | NA | 4.79E-07 | mr1617_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207908595 | 5.40E-06 | 6.57E-08 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |