\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207884913:

Variant ID: vg0207884913 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7884913
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATAATTGACAATGATCAAGAACACAATGGATCTGAACCAAGGAAACTGATCACAGATGCATGCTACTAATCACATATGTATGTACTCCACTAAGCAAGA[A/C]
TATGTTGGAAATATGGTCATATATCGGCATATTTTAATCCAAAATATTAAGACAATAACCATGGCATGAACAATGTGGGGTGATCTAGTGACAACATGTA

Reverse complement sequence

TACATGTTGTCACTAGATCACCCCACATTGTTCATGCCATGGTTATTGTCTTAATATTTTGGATTAAAATATGCCGATATATGACCATATTTCCAACATA[T/G]
TCTTGCTTAGTGGAGTACATACATATGTGATTAGTAGCATGCATCTGTGATCAGTTTCCTTGGTTCAGATCCATTGTGTTCTTGATCATTGTCAATTATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 2.50% 1.02% 6.92% NA
All Indica  2759 92.00% 4.30% 1.27% 2.39% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.13% NA
Aus  269 20.80% 0.00% 3.35% 75.84% NA
Indica I  595 86.20% 10.30% 2.86% 0.67% NA
Indica II  465 94.20% 0.00% 1.51% 4.30% NA
Indica III  913 96.40% 1.60% 0.00% 1.97% NA
Indica Intermediate  786 90.10% 5.50% 1.40% 3.05% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 51.00% 0.00% 2.08% 46.88% NA
Intermediate  90 86.70% 0.00% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207884913 A -> DEL N N silent_mutation Average:18.9; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0207884913 A -> C LOC_Os02g14360.1 downstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:18.9; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0207884913 A -> C LOC_Os02g14370.1 intron_variant ; MODIFIER silent_mutation Average:18.9; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207884913 1.88E-06 6.41E-07 mr1171 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 6.20E-06 2.49E-06 mr1520 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 NA 9.25E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 NA 2.27E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 6.04E-07 6.04E-07 mr1344_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 NA 4.24E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 2.47E-06 2.47E-06 mr1464_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 2.87E-06 2.87E-06 mr1512_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 NA 1.08E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 9.41E-06 1.40E-08 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 NA 7.54E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913 NA 3.41E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251