Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207884913:

Variant ID: vg0207884913 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7884913
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATAATTGACAATGATCAAGAACACAATGGATCTGAACCAAGGAAACTGATCACAGATGCATGCTACTAATCACATATGTATGTACTCCACTAAGCAAGA[A/C]
TATGTTGGAAATATGGTCATATATCGGCATATTTTAATCCAAAATATTAAGACAATAACCATGGCATGAACAATGTGGGGTGATCTAGTGACAACATGTA

Reverse complement sequence

TACATGTTGTCACTAGATCACCCCACATTGTTCATGCCATGGTTATTGTCTTAATATTTTGGATTAAAATATGCCGATATATGACCATATTTCCAACATA[T/G]
TCTTGCTTAGTGGAGTACATACATATGTGATTAGTAGCATGCATCTGTGATCAGTTTCCTTGGTTCAGATCCATTGTGTTCTTGATCATTGTCAATTATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	2.50%	1.02%	6.92%	NA
All Indica	2759	92.00%	4.30%	1.27%	2.39%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.13%	NA
Aus	269	20.80%	0.00%	3.35%	75.84%	NA
Indica I	595	86.20%	10.30%	2.86%	0.67%	NA
Indica II	465	94.20%	0.00%	1.51%	4.30%	NA
Indica III	913	96.40%	1.60%	0.00%	1.97%	NA
Indica Intermediate	786	90.10%	5.50%	1.40%	3.05%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	51.00%	0.00%	2.08%	46.88%	NA
Intermediate	90	86.70%	0.00%	2.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207884913	A -> DEL	N	N	silent_mutation	Average:18.9; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg0207884913	A -> C	LOC_Os02g14360.1	downstream_gene_variant ; 2942.0bp to feature; MODIFIER	silent_mutation	Average:18.9; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg0207884913	A -> C	LOC_Os02g14370.1	intron_variant ; MODIFIER	silent_mutation	Average:18.9; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207884913	1.88E-06	6.41E-07	mr1171	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	6.20E-06	2.49E-06	mr1520	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	NA	9.25E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	NA	2.27E-06	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	6.04E-07	6.04E-07	mr1344_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	NA	4.24E-06	mr1381_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	2.47E-06	2.47E-06	mr1464_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	2.87E-06	2.87E-06	mr1512_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	NA	1.08E-06	mr1617_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	9.41E-06	1.40E-08	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	NA	7.54E-06	mr1767_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207884913	NA	3.41E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251