Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207824124:

Variant ID: vg0207824124 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7824124
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCGGTCATGTGCTGCGAACAACCGGAATCCACGATCCACACGTTCTCCTTCCTCGCCACCAAAGCCTACACACAAGAAGAAGTTGAAGCCTTAGTACTA[G/A]
GGTTAGATGATAATAAAAATTTAGGAATCCAGTACTGAGACACACGACTAGTATGATGTCTAGTATGATGAGCATAAGGATTAAAACCTAAATCACGATT

Reverse complement sequence

AATCGTGATTTAGGTTTTAATCCTTATGCTCATCATACTAGACATCATACTAGTCGTGTGTCTCAGTACTGGATTCCTAAATTTTTATTATCATCTAACC[C/T]
TAGTACTAAGGCTTCAACTTCTTCTTGTGTGTAGGCTTTGGTGGCGAGGAAGGAGAACGTGTGGATCGTGGATTCCGGTTGTTCGCAGCACATGACCGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.40% 1.30% 0.32% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 95.00% 4.00% 0.93% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 92.30% 6.10% 1.56% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 94.20% 5.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207824124 G -> A LOC_Os02g14260.1 intron_variant ; MODIFIER silent_mutation Average:29.365; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207824124 1.11E-07 1.20E-07 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 1.06E-06 9.95E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 4.75E-06 3.56E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 5.75E-06 NA mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 NA 2.60E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 5.28E-06 5.28E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 2.61E-09 5.20E-09 mr1305_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 6.63E-06 NA mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207824124 7.76E-09 2.77E-08 mr1585_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251