Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207710652:

Variant ID: vg0207710652 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 7710652
Reference Allele: TAlternative Allele: G,TG
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTAATGCTATTCATGAGGTCACTAAAACGAAATGAAGCTACTTCCTCTTCCCTCTTCGGCCAATGAAATGAGGCTTGCAAGCGGCGGCGTTTTTTTTT[T/G,TG]
GGGGGGTGGTCTATTGACCTTTAAGATGGTTGTACTAGAGAAATAATCCAGTGAACATGCTGGTGTTTCTCCAACTTCGGATTTTCCCTGTATGGAGGAG

Reverse complement sequence

CTCCTCCATACAGGGAAAATCCGAAGTTGGAGAAACACCAGCATGTTCACTGGATTATTTCTCTAGTACAACCATCTTAAAGGTCAATAGACCACCCCCC[A/C,CA]
AAAAAAAAACGCCGCCGCTTGCAAGCCTCATTTCATTGGCCGAAGAGGGAAGAGGAAGTAGCTTCATTTCGTTTTAGTGACCTCATGAATAGCATTAGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 12.80% 0.19% 0.00% TG: 0.15%
All Indica  2759 94.80% 5.10% 0.11% 0.00% NA
All Japonica  1512 70.60% 28.70% 0.26% 0.00% TG: 0.46%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.70% 1.00% 0.34% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.20% 0.13% 0.00% NA
Temperate Japonica  767 92.60% 7.40% 0.00% 0.00% NA
Tropical Japonica  504 53.00% 45.60% 0.79% 0.00% TG: 0.60%
Japonica Intermediate  241 37.30% 61.00% 0.00% 0.00% TG: 1.66%
VI/Aromatic  96 80.20% 18.80% 1.04% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207710652 T -> G LOC_Os02g14110.1 3_prime_UTR_variant ; 64.0bp to feature; MODIFIER silent_mutation Average:77.945; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N
vg0207710652 T -> G LOC_Os02g14120.1 3_prime_UTR_variant ; 736.0bp to feature; MODIFIER silent_mutation Average:77.945; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N
vg0207710652 T -> TG LOC_Os02g14110.1 3_prime_UTR_variant ; 71.0bp to feature; MODIFIER silent_mutation Average:77.945; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N
vg0207710652 T -> TG LOC_Os02g14120.1 3_prime_UTR_variant ; 735.0bp to feature; MODIFIER silent_mutation Average:77.945; most accessible tissue: Zhenshan97 flower, score: 89.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207710652 T G -0.04 -0.02 -0.01 -0.01 -0.02 -0.01
vg0207710652 T TG -0.02 -0.01 0.04 0.0 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207710652 NA 1.54E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 9.29E-06 9.29E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 4.88E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 4.28E-06 4.26E-06 mr1197_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 4.18E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 1.80E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 3.88E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 2.69E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 8.95E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 2.17E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 1.33E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 5.69E-06 5.70E-06 mr1703_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 8.14E-07 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 7.33E-06 mr1706_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 8.26E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 5.76E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 1.03E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 8.80E-06 8.80E-06 mr1777_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 1.75E-06 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 5.29E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 8.95E-06 8.95E-06 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207710652 NA 3.68E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251