\
| Variant ID: vg0207692645 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7692645 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 213. )
AGATTCTTCTCCACGTACGAAGATGATAGGTCCGTTTGACACAGCTCCAGAGCTCAGCCAAATAATTTCAGCTCCACTTAAAATGGGTACAGAGCTGACT[A/G]
GAGCACTATCATAAAATAAACTAGAGATGTGGAGCTGGGTTTGGGCTTGTCGGAGGACGAACTCCTCGAGCGGGGGACCGTGAGGCCCCTCCTTTGTTGG
CCAACAAAGGAGGGGCCTCACGGTCCCCCGCTCGAGGAGTTCGTCCTCCGACAAGCCCAAACCCAGCTCCACATCTCTAGTTTATTTTATGATAGTGCTC[T/C]
AGTCAGCTCTGTACCCATTTTAAGTGGAGCTGAAATTATTTGGCTGAGCTCTGGAGCTGTGTCAAACGGACCTATCATCTTCGTACGTGGAGAAGAATCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 28.80% | 71.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 14.90% | 84.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 57.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.10% | 36.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207692645 | A -> G | LOC_Os02g14080.1 | downstream_gene_variant ; 2893.0bp to feature; MODIFIER | silent_mutation | Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 | N | N | N | N |
| vg0207692645 | A -> G | LOC_Os02g14090.1 | downstream_gene_variant ; 391.0bp to feature; MODIFIER | silent_mutation | Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 | N | N | N | N |
| vg0207692645 | A -> G | LOC_Os02g14100.1 | downstream_gene_variant ; 2829.0bp to feature; MODIFIER | silent_mutation | Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 | N | N | N | N |
| vg0207692645 | A -> G | LOC_Os02g14090-LOC_Os02g14100 | intergenic_region ; MODIFIER | silent_mutation | Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207692645 | NA | 4.75E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 6.82E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 1.15E-31 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 9.04E-15 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | 5.89E-06 | NA | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 2.13E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 9.09E-11 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 8.01E-09 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 1.22E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | 2.06E-06 | NA | mr1764_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207692645 | NA | 7.10E-07 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |