Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207692645:

Variant ID: vg0207692645 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7692645
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AGATTCTTCTCCACGTACGAAGATGATAGGTCCGTTTGACACAGCTCCAGAGCTCAGCCAAATAATTTCAGCTCCACTTAAAATGGGTACAGAGCTGACT[A/G]
GAGCACTATCATAAAATAAACTAGAGATGTGGAGCTGGGTTTGGGCTTGTCGGAGGACGAACTCCTCGAGCGGGGGACCGTGAGGCCCCTCCTTTGTTGG

Reverse complement sequence

CCAACAAAGGAGGGGCCTCACGGTCCCCCGCTCGAGGAGTTCGTCCTCCGACAAGCCCAAACCCAGCTCCACATCTCTAGTTTATTTTATGATAGTGCTC[T/C]
AGTCAGCTCTGTACCCATTTTAAGTGGAGCTGAAATTATTTGGCTGAGCTCTGGAGCTGTGTCAAACGGACCTATCATCTTCGTACGTGGAGAAGAATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	31.30%	0.02%	0.00%	NA
All Indica	2759	97.70%	2.30%	0.00%	0.00%	NA
All Japonica	1512	28.80%	71.20%	0.00%	0.00%	NA
Aus	269	14.90%	84.80%	0.37%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	97.60%	2.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.20%	3.80%	0.00%	0.00%	NA
Temperate Japonica	767	9.10%	90.90%	0.00%	0.00%	NA
Tropical Japonica	504	42.50%	57.50%	0.00%	0.00%	NA
Japonica Intermediate	241	63.10%	36.90%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207692645	A -> G	LOC_Os02g14080.1	downstream_gene_variant ; 2893.0bp to feature; MODIFIER	silent_mutation	Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N
vg0207692645	A -> G	LOC_Os02g14090.1	downstream_gene_variant ; 391.0bp to feature; MODIFIER	silent_mutation	Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N
vg0207692645	A -> G	LOC_Os02g14100.1	downstream_gene_variant ; 2829.0bp to feature; MODIFIER	silent_mutation	Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N
vg0207692645	A -> G	LOC_Os02g14090-LOC_Os02g14100	intergenic_region ; MODIFIER	silent_mutation	Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207692645	NA	4.75E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	6.82E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	1.15E-31	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	9.04E-15	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	5.89E-06	NA	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	2.13E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	9.09E-11	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	8.01E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	1.22E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	2.06E-06	NA	mr1764_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645	NA	7.10E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251