\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207692645:

Variant ID: vg0207692645 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7692645
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTCTTCTCCACGTACGAAGATGATAGGTCCGTTTGACACAGCTCCAGAGCTCAGCCAAATAATTTCAGCTCCACTTAAAATGGGTACAGAGCTGACT[A/G]
GAGCACTATCATAAAATAAACTAGAGATGTGGAGCTGGGTTTGGGCTTGTCGGAGGACGAACTCCTCGAGCGGGGGACCGTGAGGCCCCTCCTTTGTTGG

Reverse complement sequence

CCAACAAAGGAGGGGCCTCACGGTCCCCCGCTCGAGGAGTTCGTCCTCCGACAAGCCCAAACCCAGCTCCACATCTCTAGTTTATTTTATGATAGTGCTC[T/C]
AGTCAGCTCTGTACCCATTTTAAGTGGAGCTGAAATTATTTGGCTGAGCTCTGGAGCTGTGTCAAACGGACCTATCATCTTCGTACGTGGAGAAGAATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 31.30% 0.02% 0.00% NA
All Indica  2759 97.70% 2.30% 0.00% 0.00% NA
All Japonica  1512 28.80% 71.20% 0.00% 0.00% NA
Aus  269 14.90% 84.80% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 9.10% 90.90% 0.00% 0.00% NA
Tropical Japonica  504 42.50% 57.50% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.90% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207692645 A -> G LOC_Os02g14080.1 downstream_gene_variant ; 2893.0bp to feature; MODIFIER silent_mutation Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0207692645 A -> G LOC_Os02g14090.1 downstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0207692645 A -> G LOC_Os02g14100.1 downstream_gene_variant ; 2829.0bp to feature; MODIFIER silent_mutation Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N
vg0207692645 A -> G LOC_Os02g14090-LOC_Os02g14100 intergenic_region ; MODIFIER silent_mutation Average:74.159; most accessible tissue: Minghui63 flag leaf, score: 86.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207692645 NA 4.75E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 6.82E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 1.15E-31 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 9.04E-15 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 5.89E-06 NA mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 2.13E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 9.09E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 8.01E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 1.22E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 2.06E-06 NA mr1764_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207692645 NA 7.10E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251