\
| Variant ID: vg0207655807 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7655807 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAATCCTAGTCAAGGTTTGTAAGGAATGTGTTTTTATGGAAACTCCGTTCGTAGGACTACCTTGCATGACGCCGTTAATTTTTGTGTTTGACGTTTGAC[C/T]
ATTCGTCTTATGTAAAAAATTTATATAATTATCATTTATTTTAATGTGACTTGATTCATTAAATGTTCTTTAAGCATGGCATAAATATTTTTATATTTAC
GTAAATATAAAAATATTTATGCCATGCTTAAAGAACATTTAATGAATCAAGTCACATTAAAATAAATGATAATTATATAAATTTTTTACATAAGACGAAT[G/A]
GTCAAACGTCAAACACAAAAATTAACGGCGTCATGCAAGGTAGTCCTACGAACGGAGTTTCCATAAAAACACATTCCTTACAAACCTTGACTAGGATTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 5.70% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.40% | 0.46% | 0.00% | NA |
| Aus | 269 | 36.80% | 58.70% | 4.46% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 0.40% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 56.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207655807 | C -> T | LOC_Os02g14020.1 | downstream_gene_variant ; 176.0bp to feature; MODIFIER | silent_mutation | Average:91.693; most accessible tissue: Callus, score: 95.617 | N | N | N | N |
| vg0207655807 | C -> T | LOC_Os02g14030.1 | downstream_gene_variant ; 2894.0bp to feature; MODIFIER | silent_mutation | Average:91.693; most accessible tissue: Callus, score: 95.617 | N | N | N | N |
| vg0207655807 | C -> T | LOC_Os02g14020-LOC_Os02g14030 | intergenic_region ; MODIFIER | silent_mutation | Average:91.693; most accessible tissue: Callus, score: 95.617 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207655807 | NA | 5.04E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 8.29E-10 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 8.29E-06 | mr1684 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 2.39E-06 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 9.61E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 1.51E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 1.15E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 8.90E-08 | mr1465_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 2.01E-09 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 1.80E-08 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 5.31E-10 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | 2.43E-06 | NA | mr1711_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 2.49E-08 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207655807 | NA | 5.37E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |