Variant ID: vg0207527515 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 7527515 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATACTTGTAAGTAATAGACCGATTGTATTAGAATGTCGTATTTGTTATATAGCAAACTATAGGCATGTGGATCTAGGCCTGCCACTCGGTATTCATTAC[C/T]
CATCCGATATCCATACCCACATTATTTATGTAGGGTATAGGTAAACAAATTTACCCATTTAAAATTTGGATTTGTGGAGTGTATTACCTATTTTACCCAC
GTGGGTAAAATAGGTAATACACTCCACAAATCCAAATTTTAAATGGGTAAATTTGTTTACCTATACCCTACATAAATAATGTGGGTATGGATATCGGATG[G/A]
GTAATGAATACCGAGTGGCAGGCCTAGATCCACATGCCTATAGTTTGCTATATAACAAATACGACATTCTAATACAATCGGTCTATTACTTACAAGTATC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.40% | 2.80% | 0.78% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 89.20% | 8.40% | 2.38% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 98.60% | 0.00% | 1.43% | 0.00% | NA |
Tropical Japonica | 504 | 72.00% | 24.80% | 3.17% | 0.00% | NA |
Japonica Intermediate | 241 | 95.40% | 0.80% | 3.73% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0207527515 | C -> T | LOC_Os02g13880.1 | upstream_gene_variant ; 2952.0bp to feature; MODIFIER | silent_mutation | Average:53.73; most accessible tissue: Callus, score: 84.193 | N | N | N | N |
vg0207527515 | C -> T | LOC_Os02g13880-LOC_Os02g13890 | intergenic_region ; MODIFIER | silent_mutation | Average:53.73; most accessible tissue: Callus, score: 84.193 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0207527515 | NA | 5.79E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207527515 | 7.13E-06 | 1.52E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207527515 | NA | 7.17E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207527515 | 4.54E-06 | 2.93E-09 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207527515 | NA | 9.83E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |