\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207488696:

Variant ID: vg0207488696 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7488696
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAAATTTGGAGCTGATTTTGAGATTTTTTTTCATCAAAATTTATTTTTCAGCTTTTGCTTTTAGATCACTAGGAACATGTATATAAAAATTTTATTCA[C/T]
AAATTATTTTTCTTTTACAAATATGTCGTTTTGCTTATCCCGCGAATAAGTGAAACAATGGCTCCGAAAACATAGCTATATATTTATGGCTATGACTAGA

Reverse complement sequence

TCTAGTCATAGCCATAAATATATAGCTATGTTTTCGGAGCCATTGTTTCACTTATTCGCGGGATAAGCAAAACGACATATTTGTAAAAGAAAAATAATTT[G/A]
TGAATAAAATTTTTATATACATGTTCCTAGTGATCTAAAAGCAAAAGCTGAAAAATAAATTTTGATGAAAAAAAATCTCAAAATCAGCTCCAAATTTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 38.00% 0.21% 0.00% NA
All Indica  2759 90.00% 9.70% 0.25% 0.00% NA
All Japonica  1512 3.00% 96.90% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 88.60% 10.80% 0.65% 0.00% NA
Indica III  913 83.80% 16.10% 0.11% 0.00% NA
Indica Intermediate  786 90.80% 9.00% 0.13% 0.00% NA
Temperate Japonica  767 2.10% 97.80% 0.13% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 95.90% 0.41% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207488696 C -> T LOC_Os02g13840.1 upstream_gene_variant ; 2469.0bp to feature; MODIFIER silent_mutation Average:29.127; most accessible tissue: Callus, score: 60.544 N N N N
vg0207488696 C -> T LOC_Os02g13830.1 downstream_gene_variant ; 1695.0bp to feature; MODIFIER silent_mutation Average:29.127; most accessible tissue: Callus, score: 60.544 N N N N
vg0207488696 C -> T LOC_Os02g13830-LOC_Os02g13840 intergenic_region ; MODIFIER silent_mutation Average:29.127; most accessible tissue: Callus, score: 60.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207488696 NA 4.16E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 4.68E-24 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 3.53E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 2.89E-28 mr1383 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 8.64E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 3.14E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 1.03E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 2.06E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 2.41E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 2.42E-23 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207488696 NA 2.01E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251