\
| Variant ID: vg0207488696 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7488696 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTAAATTTGGAGCTGATTTTGAGATTTTTTTTCATCAAAATTTATTTTTCAGCTTTTGCTTTTAGATCACTAGGAACATGTATATAAAAATTTTATTCA[C/T]
AAATTATTTTTCTTTTACAAATATGTCGTTTTGCTTATCCCGCGAATAAGTGAAACAATGGCTCCGAAAACATAGCTATATATTTATGGCTATGACTAGA
TCTAGTCATAGCCATAAATATATAGCTATGTTTTCGGAGCCATTGTTTCACTTATTCGCGGGATAAGCAAAACGACATATTTGTAAAAGAAAAATAATTT[G/A]
TGAATAAAATTTTTATATACATGTTCCTAGTGATCTAAAAGCAAAAGCTGAAAAATAAATTTTGATGAAAAAAAATCTCAAAATCAGCTCCAAATTTAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 38.00% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 90.00% | 9.70% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 3.00% | 96.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 88.60% | 10.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 83.80% | 16.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.80% | 9.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 95.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207488696 | C -> T | LOC_Os02g13840.1 | upstream_gene_variant ; 2469.0bp to feature; MODIFIER | silent_mutation | Average:29.127; most accessible tissue: Callus, score: 60.544 | N | N | N | N |
| vg0207488696 | C -> T | LOC_Os02g13830.1 | downstream_gene_variant ; 1695.0bp to feature; MODIFIER | silent_mutation | Average:29.127; most accessible tissue: Callus, score: 60.544 | N | N | N | N |
| vg0207488696 | C -> T | LOC_Os02g13830-LOC_Os02g13840 | intergenic_region ; MODIFIER | silent_mutation | Average:29.127; most accessible tissue: Callus, score: 60.544 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207488696 | NA | 4.16E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 4.68E-24 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 3.53E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 2.89E-28 | mr1383 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 8.64E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 3.14E-17 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 1.03E-10 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 2.06E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 2.41E-18 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 2.42E-23 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207488696 | NA | 2.01E-19 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |