Variant ID: vg0207460210 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 7460210 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCCGATCCCAGTCGTAGCCGATCCGGATTCCAGCCGATTCTTACTCTGTTTCCGCGATAATCCTTATCTTTGATTCCGCTTCGATCTAATCTTCCTTTC[T/C]
GATGCTGATATTACCAAATTTGGTCGTTAACAGAAGTACAATGCCAAAGCCGTTGACGGTTTGGCAGGACTTCTAGAAAGGAAAAAAATAAAACCAAACG
CGTTTGGTTTTATTTTTTTCCTTTCTAGAAGTCCTGCCAAACCGTCAACGGCTTTGGCATTGTACTTCTGTTAACGACCAAATTTGGTAATATCAGCATC[A/G]
GAAAGGAAGATTAGATCGAAGCGGAATCAAAGATAAGGATTATCGCGGAAACAGAGTAAGAATCGGCTGGAATCCGGATCGGCTACGACTGGGATCGGCT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 62.90% | 32.50% | 0.13% | 4.40% | NA |
All Indica | 2759 | 92.20% | 0.80% | 0.14% | 6.78% | NA |
All Japonica | 1512 | 2.80% | 95.90% | 0.00% | 1.32% | NA |
Aus | 269 | 97.40% | 2.20% | 0.37% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 89.70% | 1.30% | 0.22% | 8.82% | NA |
Indica III | 913 | 88.90% | 0.20% | 0.11% | 10.73% | NA |
Indica Intermediate | 786 | 91.90% | 1.80% | 0.25% | 6.11% | NA |
Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 3.60% | 92.50% | 0.00% | 3.97% | NA |
Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 65.60% | 32.20% | 1.11% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0207460210 | T -> DEL | N | N | silent_mutation | Average:53.893; most accessible tissue: Callus, score: 70.683 | N | N | N | N |
vg0207460210 | T -> C | LOC_Os02g13800.1 | upstream_gene_variant ; 3722.0bp to feature; MODIFIER | silent_mutation | Average:53.893; most accessible tissue: Callus, score: 70.683 | N | N | N | N |
vg0207460210 | T -> C | LOC_Os02g13790-LOC_Os02g13800 | intergenic_region ; MODIFIER | silent_mutation | Average:53.893; most accessible tissue: Callus, score: 70.683 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0207460210 | 6.42E-06 | NA | mr1012 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207460210 | NA | 4.18E-34 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207460210 | NA | 6.77E-35 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207460210 | NA | 1.67E-15 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207460210 | NA | 1.37E-09 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207460210 | NA | 6.12E-16 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207460210 | NA | 3.31E-17 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |