\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207460210:

Variant ID: vg0207460210 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7460210
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCGATCCCAGTCGTAGCCGATCCGGATTCCAGCCGATTCTTACTCTGTTTCCGCGATAATCCTTATCTTTGATTCCGCTTCGATCTAATCTTCCTTTC[T/C]
GATGCTGATATTACCAAATTTGGTCGTTAACAGAAGTACAATGCCAAAGCCGTTGACGGTTTGGCAGGACTTCTAGAAAGGAAAAAAATAAAACCAAACG

Reverse complement sequence

CGTTTGGTTTTATTTTTTTCCTTTCTAGAAGTCCTGCCAAACCGTCAACGGCTTTGGCATTGTACTTCTGTTAACGACCAAATTTGGTAATATCAGCATC[A/G]
GAAAGGAAGATTAGATCGAAGCGGAATCAAAGATAAGGATTATCGCGGAAACAGAGTAAGAATCGGCTGGAATCCGGATCGGCTACGACTGGGATCGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 32.50% 0.13% 4.40% NA
All Indica  2759 92.20% 0.80% 0.14% 6.78% NA
All Japonica  1512 2.80% 95.90% 0.00% 1.32% NA
Aus  269 97.40% 2.20% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 89.70% 1.30% 0.22% 8.82% NA
Indica III  913 88.90% 0.20% 0.11% 10.73% NA
Indica Intermediate  786 91.90% 1.80% 0.25% 6.11% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 92.50% 0.00% 3.97% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 65.60% 32.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207460210 T -> DEL N N silent_mutation Average:53.893; most accessible tissue: Callus, score: 70.683 N N N N
vg0207460210 T -> C LOC_Os02g13800.1 upstream_gene_variant ; 3722.0bp to feature; MODIFIER silent_mutation Average:53.893; most accessible tissue: Callus, score: 70.683 N N N N
vg0207460210 T -> C LOC_Os02g13790-LOC_Os02g13800 intergenic_region ; MODIFIER silent_mutation Average:53.893; most accessible tissue: Callus, score: 70.683 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207460210 6.42E-06 NA mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207460210 NA 4.18E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207460210 NA 6.77E-35 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207460210 NA 1.67E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207460210 NA 1.37E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207460210 NA 6.12E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207460210 NA 3.31E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251