\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207453789:

Variant ID: vg0207453789 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7453789
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGAACGGAGGTAGTATCACGTATATACAACACAATATGAATATTACACATGGATAGTTTGGTCAAGTTAGTACAAAATTTAAATATGTTGTTATTTT[A/C]
AGAAATTCTAATAATAAAATAAGAAAATATATATGTTATTATATGAGAGAAAGGATAAGAATACTAGCCGCGTAATTTACGGGGCCCTATACTAATCTAT

Reverse complement sequence

ATAGATTAGTATAGGGCCCCGTAAATTACGCGGCTAGTATTCTTATCCTTTCTCTCATATAATAACATATATATTTTCTTATTTTATTATTAGAATTTCT[T/G]
AAAATAACAACATATTTAAATTTTGTACTAACTTGACCAAACTATCCATGTGTAATATTCATATTGTGTTGTATATACGTGATACTACCTCCGTTCCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 45.80% 0.23% 4.04% NA
All Indica  2759 82.50% 10.40% 0.29% 6.85% NA
All Japonica  1512 2.50% 97.40% 0.07% 0.07% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 91.10% 8.70% 0.17% 0.00% NA
Indica II  465 85.20% 5.20% 0.86% 8.82% NA
Indica III  913 77.00% 12.20% 0.00% 10.84% NA
Indica Intermediate  786 80.70% 12.70% 0.38% 6.23% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 96.00% 0.20% 0.20% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 46.70% 50.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207453789 A -> DEL N N silent_mutation Average:28.235; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0207453789 A -> C LOC_Os02g13790.1 downstream_gene_variant ; 3558.0bp to feature; MODIFIER silent_mutation Average:28.235; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0207453789 A -> C LOC_Os02g13790-LOC_Os02g13800 intergenic_region ; MODIFIER silent_mutation Average:28.235; most accessible tissue: Minghui63 root, score: 41.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207453789 NA 5.83E-39 mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 1.29E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 6.66E-36 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 1.41E-39 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 2.82E-17 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 1.04E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 4.87E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 4.78E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 7.02E-49 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 1.12E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 3.27E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 3.02E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789 NA 2.58E-33 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251