Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207453789:

Variant ID: vg0207453789 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7453789
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGGAACGGAGGTAGTATCACGTATATACAACACAATATGAATATTACACATGGATAGTTTGGTCAAGTTAGTACAAAATTTAAATATGTTGTTATTTT[A/C]
AGAAATTCTAATAATAAAATAAGAAAATATATATGTTATTATATGAGAGAAAGGATAAGAATACTAGCCGCGTAATTTACGGGGCCCTATACTAATCTAT

Reverse complement sequence

ATAGATTAGTATAGGGCCCCGTAAATTACGCGGCTAGTATTCTTATCCTTTCTCTCATATAATAACATATATATTTTCTTATTTTATTATTAGAATTTCT[T/G]
AAAATAACAACATATTTAAATTTTGTACTAACTTGACCAAACTATCCATGTGTAATATTCATATTGTGTTGTATATACGTGATACTACCTCCGTTCCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	45.80%	0.23%	4.04%	NA
All Indica	2759	82.50%	10.40%	0.29%	6.85%	NA
All Japonica	1512	2.50%	97.40%	0.07%	0.07%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	91.10%	8.70%	0.17%	0.00%	NA
Indica II	465	85.20%	5.20%	0.86%	8.82%	NA
Indica III	913	77.00%	12.20%	0.00%	10.84%	NA
Indica Intermediate	786	80.70%	12.70%	0.38%	6.23%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	3.60%	96.00%	0.20%	0.20%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	46.70%	50.00%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207453789	A -> DEL	N	N	silent_mutation	Average:28.235; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N
vg0207453789	A -> C	LOC_Os02g13790.1	downstream_gene_variant ; 3558.0bp to feature; MODIFIER	silent_mutation	Average:28.235; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N
vg0207453789	A -> C	LOC_Os02g13790-LOC_Os02g13800	intergenic_region ; MODIFIER	silent_mutation	Average:28.235; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207453789	NA	5.83E-39	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	1.29E-48	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	6.66E-36	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	1.41E-39	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	2.82E-17	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	1.04E-16	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	4.87E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	4.78E-18	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	7.02E-49	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	1.12E-33	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	3.27E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	3.02E-19	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207453789	NA	2.58E-33	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251