\
| Variant ID: vg0207368924 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7368924 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATGATTAGTATTTTTATTGTTACTAGATGATAAAACATGAATATTACTTTGTGTGACTAATTTTTTAAACTTTTTATTGTAAATTTTTCAAATAAGATA[C/T,A]
CCACGGTTGTACTTATTTTAGAACGAAAGTAGTACTTTGTTATACTACTGCATACTGTGTCACTGAAACGAACTGAGTAACACAGCAACTTAGTTCGAAG
CTTCGAACTAAGTTGCTGTGTTACTCAGTTCGTTTCAGTGACACAGTATGCAGTAGTATAACAAAGTACTACTTTCGTTCTAAAATAAGTACAACCGTGG[G/A,T]
TATCTTATTTGAAAAATTTACAATAAAAAGTTTAAAAAATTAGTCACACAAAGTAATATTCATGTTTTATCATCTAGTAACAATAAAAATACTAATCATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.40% | 0.36% | 0.00% | A: 0.21% |
| All Indica | 2759 | 99.70% | 0.00% | 0.00% | 0.00% | A: 0.29% |
| All Japonica | 1512 | 75.50% | 23.40% | 1.12% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.00% | 0.00% | 0.00% | A: 0.88% |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 73.30% | 25.20% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 82.90% | 16.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.80% | 32.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 0.00% | 0.00% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207368924 | C -> A | LOC_Os02g13710.1 | downstream_gene_variant ; 2509.0bp to feature; MODIFIER | silent_mutation | Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0207368924 | C -> A | LOC_Os02g13710-LOC_Os02g13720 | intergenic_region ; MODIFIER | silent_mutation | Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0207368924 | C -> T | LOC_Os02g13710.1 | downstream_gene_variant ; 2509.0bp to feature; MODIFIER | silent_mutation | Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0207368924 | C -> T | LOC_Os02g13710-LOC_Os02g13720 | intergenic_region ; MODIFIER | silent_mutation | Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207368924 | 5.24E-07 | 1.42E-11 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207368924 | NA | 2.09E-07 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207368924 | NA | 1.08E-07 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207368924 | 5.62E-11 | 2.55E-19 | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207368924 | NA | 1.45E-09 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207368924 | NA | 3.24E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |