\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207368924:

Variant ID: vg0207368924 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7368924
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGATTAGTATTTTTATTGTTACTAGATGATAAAACATGAATATTACTTTGTGTGACTAATTTTTTAAACTTTTTATTGTAAATTTTTCAAATAAGATA[C/T,A]
CCACGGTTGTACTTATTTTAGAACGAAAGTAGTACTTTGTTATACTACTGCATACTGTGTCACTGAAACGAACTGAGTAACACAGCAACTTAGTTCGAAG

Reverse complement sequence

CTTCGAACTAAGTTGCTGTGTTACTCAGTTCGTTTCAGTGACACAGTATGCAGTAGTATAACAAAGTACTACTTTCGTTCTAAAATAAGTACAACCGTGG[G/A,T]
TATCTTATTTGAAAAATTTACAATAAAAAGTTTAAAAAATTAGTCACACAAAGTAATATTCATGTTTTATCATCTAGTAACAATAAAAATACTAATCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.40% 0.36% 0.00% A: 0.21%
All Indica  2759 99.70% 0.00% 0.00% 0.00% A: 0.29%
All Japonica  1512 75.50% 23.40% 1.12% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.00% 0.00% 0.00% A: 0.88%
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 73.30% 25.20% 1.56% 0.00% NA
Tropical Japonica  504 82.90% 16.70% 0.40% 0.00% NA
Japonica Intermediate  241 66.80% 32.00% 1.24% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 0.00% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207368924 C -> A LOC_Os02g13710.1 downstream_gene_variant ; 2509.0bp to feature; MODIFIER silent_mutation Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0207368924 C -> A LOC_Os02g13710-LOC_Os02g13720 intergenic_region ; MODIFIER silent_mutation Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0207368924 C -> T LOC_Os02g13710.1 downstream_gene_variant ; 2509.0bp to feature; MODIFIER silent_mutation Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0207368924 C -> T LOC_Os02g13710-LOC_Os02g13720 intergenic_region ; MODIFIER silent_mutation Average:49.347; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207368924 5.24E-07 1.42E-11 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368924 NA 2.09E-07 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368924 NA 1.08E-07 mr1274 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368924 5.62E-11 2.55E-19 mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368924 NA 1.45E-09 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368924 NA 3.24E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251