\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207368784:

Variant ID: vg0207368784 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7368784
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGAGCTAGTGTACGTACTACGGATTACGGATCAAACTGTCGTGTACTGTAGTACTCCCTCCCTACTATAAAATATATGTAAAGCTTTTCACTATTTAT[A/G]
TGTCCAACGTTTGATCGTTTATTTTATTTGAAATTTTTTTATGATTAGTATTTTTATTGTTACTAGATGATAAAACATGAATATTACTTTGTGTGACTAA

Reverse complement sequence

TTAGTCACACAAAGTAATATTCATGTTTTATCATCTAGTAACAATAAAAATACTAATCATAAAAAAATTTCAAATAAAATAAACGATCAAACGTTGGACA[T/C]
ATAAATAGTGAAAAGCTTTACATATATTTTATAGTAGGGAGGGAGTACTACAGTACACGACAGTTTGATCCGTAATCCGTAGTACGTACACTAGCTCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 27.60% 0.40% 0.00% NA
All Indica  2759 94.90% 5.10% 0.00% 0.00% NA
All Japonica  1512 26.50% 72.40% 1.19% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 28.00% 70.70% 1.30% 0.00% NA
Tropical Japonica  504 20.60% 78.80% 0.60% 0.00% NA
Japonica Intermediate  241 33.60% 64.30% 2.07% 0.00% NA
VI/Aromatic  96 57.30% 41.70% 1.04% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207368784 A -> G LOC_Os02g13710.1 downstream_gene_variant ; 2369.0bp to feature; MODIFIER silent_mutation Average:67.019; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg0207368784 A -> G LOC_Os02g13710-LOC_Os02g13720 intergenic_region ; MODIFIER silent_mutation Average:67.019; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207368784 A G -0.03 -0.05 -0.03 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207368784 NA 7.09E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 1.32E-06 mr1274 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 3.37E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 2.33E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 1.40E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 3.20E-08 NA mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 2.99E-08 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 1.24E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 5.78E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 6.03E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207368784 NA 4.88E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251