Variant ID: vg0207335149 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 7335149 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 227. )
GGTAATCAGGATCCAATCTGACCTATTAAATACGGGTTTTGGAGCTAATATCATCATAGTCTTAAGGAAGTAAAGGAAAAAAAATATATAATTATGCATT[A/G]
TCGGCCACCGTAATATATACTCCCTCATGTCACAATTAAATTCTTAGGTTTCAGACAAATTCTGGTTAAACTTTGACTATCATTGACTTTAATTACTTAA
TTAAGTAATTAAAGTCAATGATAGTCAAAGTTTAACCAGAATTTGTCTGAAACCTAAGAATTTAATTGTGACATGAGGGAGTATATATTACGGTGGCCGA[T/C]
AATGCATAATTATATATTTTTTTTCCTTTACTTCCTTAAGACTATGATGATATTAGCTCCAAAACCCGTATTTAATAGGTCAGATTGGATCCTGATTACC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
All Indica | 2759 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0207335149 | A -> G | LOC_Os02g13670.1 | upstream_gene_variant ; 1063.0bp to feature; MODIFIER | silent_mutation | Average:33.244; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
vg0207335149 | A -> G | LOC_Os02g13670-LOC_Os02g13690 | intergenic_region ; MODIFIER | silent_mutation | Average:33.244; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0207335149 | 2.16E-06 | 2.74E-08 | mr1053_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207335149 | 3.11E-06 | 2.07E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207335149 | NA | 3.85E-07 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207335149 | NA | 5.35E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |