\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207316810:

Variant ID: vg0207316810 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7316810
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, C: 0.29, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCCTCTCCACCTGGGCCGACATCGCTGGGCTGCAGGTGGTTGTGATTTCCGTCTCTCTATTTGGGAATCTAGGGATTTAGGAATGTGTGGTTGCGCCA[G/C]
TCCTTTTGGGGCTCGTGCGATCGTAATAATGCTCTTGTTTACCCAATTATAAGCTTGTGTAAACCATTTCTGCTATTTCTTTTATTAAAGCAACAACCTT

Reverse complement sequence

AAGGTTGTTGCTTTAATAAAAGAAATAGCAGAAATGGTTTACACAAGCTTATAATTGGGTAAACAAGAGCATTATTACGATCGCACGAGCCCCAAAAGGA[C/G]
TGGCGCAACCACACATTCCTAAATCCCTAGATTCCCAAATAGAGAGACGGAAATCACAACCACCTGCAGCCCAGCGATGTCGGCCCAGGTGGAGAGGGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.50% 0.15% 0.00% NA
All Indica  2759 84.10% 15.80% 0.14% 0.00% NA
All Japonica  1512 2.80% 97.20% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 81.00% 18.80% 0.17% 0.00% NA
Indica II  465 82.80% 17.00% 0.22% 0.00% NA
Indica III  913 83.20% 16.80% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 11.70% 0.25% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 3.80% 96.00% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 62.50% 1.04% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207316810 G -> C LOC_Os02g13630.1 upstream_gene_variant ; 2153.0bp to feature; MODIFIER silent_mutation Average:87.588; most accessible tissue: Zhenshan97 flag leaf, score: 93.581 N N N N
vg0207316810 G -> C LOC_Os02g13650.1 upstream_gene_variant ; 4637.0bp to feature; MODIFIER silent_mutation Average:87.588; most accessible tissue: Zhenshan97 flag leaf, score: 93.581 N N N N
vg0207316810 G -> C LOC_Os02g13640.1 intron_variant ; MODIFIER silent_mutation Average:87.588; most accessible tissue: Zhenshan97 flag leaf, score: 93.581 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207316810 G C 0.01 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207316810 NA 7.35E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 NA 2.31E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 1.94E-06 NA mr1679 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 6.16E-07 1.88E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 7.65E-06 7.65E-06 mr1717 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 NA 4.59E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 NA 4.09E-19 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 NA 2.82E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 NA 4.35E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 NA 4.50E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 2.97E-06 4.03E-06 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207316810 NA 2.28E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251