\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207302554:

Variant ID: vg0207302554 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7302554
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTCTGGCTTAGATTTCTTAGTGGCATGTAAAACAAAACAAGTCAATAATGTAGAATTAATTGTGTATTAATTATTATTGTTCGGGTTATGGATACCAC[A/G]
TACCTAATAGTAATTGACTAAATCTCGGCAGGACCCATCACATACCATGTCTTATATGGAAACTGACCTCAGATATGGAGGGAGTTCCGGATAAGGAAAG

Reverse complement sequence

CTTTCCTTATCCGGAACTCCCTCCATATCTGAGGTCAGTTTCCATATAAGACATGGTATGTGATGGGTCCTGCCGAGATTTAGTCAATTACTATTAGGTA[T/C]
GTGGTATCCATAACCCGAACAATAATAATTAATACACAATTAATTCTACATTATTGACTTGTTTTGTTTTACATGCCACTAAGAAATCTAAGCCAGAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 6.60% 1.71% 7.64% NA
All Indica  2759 84.40% 0.00% 2.72% 12.87% NA
All Japonica  1512 79.20% 20.20% 0.33% 0.20% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 81.80% 0.00% 6.55% 11.60% NA
Indica II  465 80.90% 0.00% 2.80% 16.34% NA
Indica III  913 85.30% 0.00% 0.88% 13.80% NA
Indica Intermediate  786 87.40% 0.00% 1.91% 10.69% NA
Temperate Japonica  767 77.30% 21.90% 0.52% 0.26% NA
Tropical Japonica  504 84.30% 15.50% 0.00% 0.20% NA
Japonica Intermediate  241 74.70% 24.90% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 7.80% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207302554 A -> G LOC_Os02g13590.1 downstream_gene_variant ; 2527.0bp to feature; MODIFIER silent_mutation Average:67.369; most accessible tissue: Callus, score: 90.355 N N N N
vg0207302554 A -> G LOC_Os02g13600.1 downstream_gene_variant ; 881.0bp to feature; MODIFIER silent_mutation Average:67.369; most accessible tissue: Callus, score: 90.355 N N N N
vg0207302554 A -> G LOC_Os02g13610.1 downstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:67.369; most accessible tissue: Callus, score: 90.355 N N N N
vg0207302554 A -> G LOC_Os02g13600-LOC_Os02g13610 intergenic_region ; MODIFIER silent_mutation Average:67.369; most accessible tissue: Callus, score: 90.355 N N N N
vg0207302554 A -> DEL N N silent_mutation Average:67.369; most accessible tissue: Callus, score: 90.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207302554 NA 8.15E-07 mr1201_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207302554 2.56E-06 NA mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207302554 NA 1.75E-07 mr1219_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207302554 NA 6.33E-06 mr1274_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251