\
| Variant ID: vg0207302554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7302554 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATTCTGGCTTAGATTTCTTAGTGGCATGTAAAACAAAACAAGTCAATAATGTAGAATTAATTGTGTATTAATTATTATTGTTCGGGTTATGGATACCAC[A/G]
TACCTAATAGTAATTGACTAAATCTCGGCAGGACCCATCACATACCATGTCTTATATGGAAACTGACCTCAGATATGGAGGGAGTTCCGGATAAGGAAAG
CTTTCCTTATCCGGAACTCCCTCCATATCTGAGGTCAGTTTCCATATAAGACATGGTATGTGATGGGTCCTGCCGAGATTTAGTCAATTACTATTAGGTA[T/C]
GTGGTATCCATAACCCGAACAATAATAATTAATACACAATTAATTCTACATTATTGACTTGTTTTGTTTTACATGCCACTAAGAAATCTAAGCCAGAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 6.60% | 1.71% | 7.64% | NA |
| All Indica | 2759 | 84.40% | 0.00% | 2.72% | 12.87% | NA |
| All Japonica | 1512 | 79.20% | 20.20% | 0.33% | 0.20% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.80% | 0.00% | 6.55% | 11.60% | NA |
| Indica II | 465 | 80.90% | 0.00% | 2.80% | 16.34% | NA |
| Indica III | 913 | 85.30% | 0.00% | 0.88% | 13.80% | NA |
| Indica Intermediate | 786 | 87.40% | 0.00% | 1.91% | 10.69% | NA |
| Temperate Japonica | 767 | 77.30% | 21.90% | 0.52% | 0.26% | NA |
| Tropical Japonica | 504 | 84.30% | 15.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 74.70% | 24.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207302554 | A -> G | LOC_Os02g13590.1 | downstream_gene_variant ; 2527.0bp to feature; MODIFIER | silent_mutation | Average:67.369; most accessible tissue: Callus, score: 90.355 | N | N | N | N |
| vg0207302554 | A -> G | LOC_Os02g13600.1 | downstream_gene_variant ; 881.0bp to feature; MODIFIER | silent_mutation | Average:67.369; most accessible tissue: Callus, score: 90.355 | N | N | N | N |
| vg0207302554 | A -> G | LOC_Os02g13610.1 | downstream_gene_variant ; 539.0bp to feature; MODIFIER | silent_mutation | Average:67.369; most accessible tissue: Callus, score: 90.355 | N | N | N | N |
| vg0207302554 | A -> G | LOC_Os02g13600-LOC_Os02g13610 | intergenic_region ; MODIFIER | silent_mutation | Average:67.369; most accessible tissue: Callus, score: 90.355 | N | N | N | N |
| vg0207302554 | A -> DEL | N | N | silent_mutation | Average:67.369; most accessible tissue: Callus, score: 90.355 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207302554 | NA | 8.15E-07 | mr1201_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207302554 | 2.56E-06 | NA | mr1219_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207302554 | NA | 1.75E-07 | mr1219_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207302554 | NA | 6.33E-06 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |