\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207224194:

Variant ID: vg0207224194 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7224194
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGTGGGGAAATCACCGGTGAGATTGTTGCAAGAGAGGTCTATGTAGGTCAGATTCTTGAGGCTACAAACGGAGGCTGGGATTGGTCTGGCTATATGGA[G/A]
ACTTGGCAAGGAGAGGCCAGTGACCTGACCTGTGCTGCTACTGATAACACCAGTCCAGTTGCCGGTGCTGCTCCATGAACTGAGTGGAGCTGGGTTGTCC

Reverse complement sequence

GGACAACCCAGCTCCACTCAGTTCATGGAGCAGCACCGGCAACTGGACTGGTGTTATCAGTAGCAGCACAGGTCAGGTCACTGGCCTCTCCTTGCCAAGT[C/T]
TCCATATAGCCAGACCAATCCCAGCCTCCGTTTGTAGCCTCAAGAATCTGACCTACATAGACCTCTCTTGCAACAATCTCACCGGTGATTTCCCCACGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 31.00% 2.81% 0.00% NA
All Indica  2759 74.30% 21.40% 4.28% 0.00% NA
All Japonica  1512 58.10% 41.90% 0.07% 0.00% NA
Aus  269 21.90% 74.00% 4.09% 0.00% NA
Indica I  595 82.40% 10.40% 7.23% 0.00% NA
Indica II  465 71.40% 25.20% 3.44% 0.00% NA
Indica III  913 75.80% 23.10% 1.10% 0.00% NA
Indica Intermediate  786 68.20% 25.60% 6.23% 0.00% NA
Temperate Japonica  767 83.30% 16.70% 0.00% 0.00% NA
Tropical Japonica  504 21.40% 78.40% 0.20% 0.00% NA
Japonica Intermediate  241 54.40% 45.60% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207224194 G -> A LOC_Os02g13510.1 missense_variant ; p.Leu72Phe; MODERATE nonsynonymous_codon ; L72F Average:92.522; most accessible tissue: Minghui63 flag leaf, score: 97.113 benign -0.083 TOLERATED 0.70

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207224194 G A -0.01 -0.03 -0.02 -0.03 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207224194 NA 4.20E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 4.94E-08 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 5.14E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 7.34E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 1.09E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 1.60E-06 9.13E-07 mr1186 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 1.79E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 2.26E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 1.98E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 6.47E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 3.38E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 6.93E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 7.61E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 1.06E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 6.98E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 6.67E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 2.60E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 3.43E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 9.81E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 1.22E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 9.40E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 6.30E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207224194 NA 7.79E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251