RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0207217318:

Variant ID: vg0207217318 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7217318
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

CACTACTCTCCACTGCCATCCATGTTGACCCCTCACTGGCCACACGGCATTTATGACAAATTTATCATGCACTGGATCTACCCCAAACATATTATACAAC[C/T]
ACCCTAACACGTCGTTCAAACCCATATACTCCGGTGCATTCAGACTAGTATCATGGAAGGCATATACAGTCAAATCCACCCCACTATCGCATATTTGTAT

Reverse complement sequence

ATACAAATATGCGATAGTGGGGTGGATTTGACTGTATATGCCTTCCATGATACTAGTCTGAATGCACCGGAGTATATGGGTTTGAACGACGTGTTAGGGT[G/A]
GTTGTATAATATGTTTGGGGTAGATCCAGTGCATGATAAATTTGTCATAAATGCCGTGTGGCCAGTGAGGGGTCAACATGGATGGCAGTGGAGAGTAGTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	5.90%	1.44%	4.76%	NA
All Indica	2759	99.50%	0.30%	0.04%	0.25%	NA
All Japonica	1512	64.00%	17.60%	4.37%	14.02%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.20%	0.22%	0.22%	NA
Indica III	913	99.20%	0.20%	0.00%	0.55%	NA
Indica Intermediate	786	99.40%	0.50%	0.00%	0.13%	NA
Temperate Japonica	767	84.40%	13.40%	0.78%	1.43%	NA
Tropical Japonica	504	34.70%	21.00%	9.72%	34.52%	NA
Japonica Intermediate	241	60.60%	23.70%	4.56%	11.20%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	92.20%	3.30%	1.11%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207217318	C -> T	LOC_Os02g13500.1	stop_gained ; p.Trp150*; HIGH	stop_gained	Average:41.594; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg0207217318	C -> DEL	LOC_Os02g13500.1	N	frameshift_variant	Average:41.594; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207217318	NA	4.78E-10	mr1045	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	8.61E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	2.27E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	1.46E-14	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	7.85E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	2.84E-06	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	6.18E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	6.06E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	1.18E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207217318	NA	1.57E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 44 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0207217318:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact