Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207183259:

Variant ID: vg0207183259 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7183259
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATATGAATGTGTGTGTGCATCTCTGCCTCTCTGGCCTTGAACTAACATGCAAAATACAGAGTAACATATAAAATACTCAGGTGGTTTTGTGTTTAACAA[T/G,A]
ATGTTGGAATCAATCCAGATAGTTGGTTCCTAGAAAGATCCAGCCTGACAAGGTTGGCGAGCTTGGACATGTCTGGAGGTAGCATGCCAGAGAACAAATT

Reverse complement sequence

AATTTGTTCTCTGGCATGCTACCTCCAGACATGTCCAAGCTCGCCAACCTTGTCAGGCTGGATCTTTCTAGGAACCAACTATCTGGATTGATTCCAACAT[A/C,T]
TTGTTAAACACAAAACCACCTGAGTATTTTATATGTTACTCTGTATTTTGCATGTTAGTTCAAGGCCAGAGAGGCAGAGATGCACACACACATTCATATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	33.90%	0.38%	0.06%	A: 13.33%
All Indica	2759	76.70%	22.40%	0.33%	0.00%	A: 0.62%
All Japonica	1512	3.20%	56.40%	0.46%	0.20%	A: 39.68%
Aus	269	82.50%	16.70%	0.00%	0.00%	A: 0.74%
Indica I	595	77.30%	22.50%	0.17%	0.00%	NA
Indica II	465	84.90%	14.00%	0.43%	0.00%	A: 0.65%
Indica III	913	76.10%	22.30%	0.66%	0.00%	A: 0.88%
Indica Intermediate	786	71.90%	27.40%	0.00%	0.00%	A: 0.76%
Temperate Japonica	767	2.00%	82.50%	0.26%	0.13%	A: 15.12%
Tropical Japonica	504	4.40%	18.80%	0.60%	0.20%	A: 75.99%
Japonica Intermediate	241	5.00%	51.90%	0.83%	0.41%	A: 41.91%
VI/Aromatic	96	42.70%	54.20%	0.00%	0.00%	A: 3.12%
Intermediate	90	53.30%	35.60%	2.22%	0.00%	A: 8.89%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207183259	T -> A	LOC_Os02g13450.1	upstream_gene_variant ; 1950.0bp to feature; MODIFIER	silent_mutation	Average:77.252; most accessible tissue: Callus, score: 94.499	N	N	N	N
vg0207183259	T -> A	LOC_Os02g13460.1	downstream_gene_variant ; 203.0bp to feature; MODIFIER	silent_mutation	Average:77.252; most accessible tissue: Callus, score: 94.499	N	N	N	N
vg0207183259	T -> A	LOC_Os02g13450-LOC_Os02g13460	intergenic_region ; MODIFIER	silent_mutation	Average:77.252; most accessible tissue: Callus, score: 94.499	N	N	N	N
vg0207183259	T -> G	LOC_Os02g13450.1	upstream_gene_variant ; 1950.0bp to feature; MODIFIER	silent_mutation	Average:77.252; most accessible tissue: Callus, score: 94.499	N	N	N	N
vg0207183259	T -> G	LOC_Os02g13460.1	downstream_gene_variant ; 203.0bp to feature; MODIFIER	silent_mutation	Average:77.252; most accessible tissue: Callus, score: 94.499	N	N	N	N
vg0207183259	T -> G	LOC_Os02g13450-LOC_Os02g13460	intergenic_region ; MODIFIER	silent_mutation	Average:77.252; most accessible tissue: Callus, score: 94.499	N	N	N	N
vg0207183259	T -> DEL	N	N	silent_mutation	Average:77.252; most accessible tissue: Callus, score: 94.499	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207183259	NA	2.22E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.62E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.51E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	1.21E-13	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	9.81E-06	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.20E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	3.94E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	3.54E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	6.07E-33	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.77E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	4.43E-07	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.62E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	1.40E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.79E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	8.59E-15	mr1232_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	8.14E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	8.85E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.87E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	6.81E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	1.57E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	7.18E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	3.72E-21	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	1.60E-07	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.41E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	3.25E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	9.43E-26	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	9.16E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	1.01E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	1.26E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.35E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.61E-07	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	8.75E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	8.68E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	5.42E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	2.36E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	4.69E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	5.34E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	8.12E-06	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	5.79E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259	NA	9.75E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251