\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207183259:

Variant ID: vg0207183259 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7183259
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATGAATGTGTGTGTGCATCTCTGCCTCTCTGGCCTTGAACTAACATGCAAAATACAGAGTAACATATAAAATACTCAGGTGGTTTTGTGTTTAACAA[T/G,A]
ATGTTGGAATCAATCCAGATAGTTGGTTCCTAGAAAGATCCAGCCTGACAAGGTTGGCGAGCTTGGACATGTCTGGAGGTAGCATGCCAGAGAACAAATT

Reverse complement sequence

AATTTGTTCTCTGGCATGCTACCTCCAGACATGTCCAAGCTCGCCAACCTTGTCAGGCTGGATCTTTCTAGGAACCAACTATCTGGATTGATTCCAACAT[A/C,T]
TTGTTAAACACAAAACCACCTGAGTATTTTATATGTTACTCTGTATTTTGCATGTTAGTTCAAGGCCAGAGAGGCAGAGATGCACACACACATTCATATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 33.90% 0.38% 0.06% A: 13.33%
All Indica  2759 76.70% 22.40% 0.33% 0.00% A: 0.62%
All Japonica  1512 3.20% 56.40% 0.46% 0.20% A: 39.68%
Aus  269 82.50% 16.70% 0.00% 0.00% A: 0.74%
Indica I  595 77.30% 22.50% 0.17% 0.00% NA
Indica II  465 84.90% 14.00% 0.43% 0.00% A: 0.65%
Indica III  913 76.10% 22.30% 0.66% 0.00% A: 0.88%
Indica Intermediate  786 71.90% 27.40% 0.00% 0.00% A: 0.76%
Temperate Japonica  767 2.00% 82.50% 0.26% 0.13% A: 15.12%
Tropical Japonica  504 4.40% 18.80% 0.60% 0.20% A: 75.99%
Japonica Intermediate  241 5.00% 51.90% 0.83% 0.41% A: 41.91%
VI/Aromatic  96 42.70% 54.20% 0.00% 0.00% A: 3.12%
Intermediate  90 53.30% 35.60% 2.22% 0.00% A: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207183259 T -> A LOC_Os02g13450.1 upstream_gene_variant ; 1950.0bp to feature; MODIFIER silent_mutation Average:77.252; most accessible tissue: Callus, score: 94.499 N N N N
vg0207183259 T -> A LOC_Os02g13460.1 downstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:77.252; most accessible tissue: Callus, score: 94.499 N N N N
vg0207183259 T -> A LOC_Os02g13450-LOC_Os02g13460 intergenic_region ; MODIFIER silent_mutation Average:77.252; most accessible tissue: Callus, score: 94.499 N N N N
vg0207183259 T -> G LOC_Os02g13450.1 upstream_gene_variant ; 1950.0bp to feature; MODIFIER silent_mutation Average:77.252; most accessible tissue: Callus, score: 94.499 N N N N
vg0207183259 T -> G LOC_Os02g13460.1 downstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:77.252; most accessible tissue: Callus, score: 94.499 N N N N
vg0207183259 T -> G LOC_Os02g13450-LOC_Os02g13460 intergenic_region ; MODIFIER silent_mutation Average:77.252; most accessible tissue: Callus, score: 94.499 N N N N
vg0207183259 T -> DEL N N silent_mutation Average:77.252; most accessible tissue: Callus, score: 94.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207183259 NA 2.22E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.62E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.51E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 1.21E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 9.81E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.20E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 3.94E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 3.54E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 6.07E-33 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.77E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 4.43E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.62E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 1.40E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.79E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 8.59E-15 mr1232_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 8.14E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 8.85E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.87E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 6.81E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 1.57E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 7.18E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 3.72E-21 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 1.60E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.41E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 3.25E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 9.43E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 9.16E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 1.01E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 1.26E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.35E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.61E-07 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 8.75E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 8.68E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 5.42E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 2.36E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 4.69E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 5.34E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 8.12E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 5.79E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207183259 NA 9.75E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251