\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207177588:

Variant ID: vg0207177588 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7177588
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTGGTTGCCTCCTTTACTGCCGGCCGCACCTCATCGTGCTGCGCCGGCCTCCACCACCGGACGCGCCTCTCGCGCCAGTTCGGCCTCCCGCCATCGGT[A/T]
ACGCCTCTCGCTCCAAGCGGGCCTCCTCGCCGCCGGCCACGCCTCTTGCGCCTTACTGGCCTCCACTGCCATCGGCTGCGCCTCTCTGCACCAAGCTGGC

Reverse complement sequence

GCCAGCTTGGTGCAGAGAGGCGCAGCCGATGGCAGTGGAGGCCAGTAAGGCGCAAGAGGCGTGGCCGGCGGCGAGGAGGCCCGCTTGGAGCGAGAGGCGT[T/A]
ACCGATGGCGGGAGGCCGAACTGGCGCGAGAGGCGCGTCCGGTGGTGGAGGCCGGCGCAGCACGATGAGGTGCGGCCGGCAGTAAAGGAGGCAACCACGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 29.10% 0.38% 13.61% NA
All Indica  2759 81.10% 17.70% 0.40% 0.76% NA
All Japonica  1512 3.50% 55.80% 0.40% 40.28% NA
Aus  269 98.90% 0.40% 0.00% 0.74% NA
Indica I  595 90.10% 9.90% 0.00% 0.00% NA
Indica II  465 86.70% 12.50% 0.22% 0.65% NA
Indica III  913 77.70% 20.30% 0.88% 1.20% NA
Indica Intermediate  786 75.10% 23.80% 0.25% 0.89% NA
Temperate Japonica  767 2.20% 81.70% 0.26% 15.78% NA
Tropical Japonica  504 4.40% 18.70% 0.60% 76.39% NA
Japonica Intermediate  241 5.80% 51.00% 0.41% 42.74% NA
VI/Aromatic  96 79.20% 17.70% 0.00% 3.12% NA
Intermediate  90 63.30% 26.70% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207177588 A -> T LOC_Os02g13440.1 synonymous_variant ; p.Val158Val; LOW synonymous_codon Average:69.194; most accessible tissue: Minghui63 young leaf, score: 85.633 N N N N
vg0207177588 A -> T LOC_Os02g13440.1 synonymous_variant ; p.Val158Val; LOW nonsynonymous_codon ; V158I Average:69.194; most accessible tissue: Minghui63 young leaf, score: 85.633 unknown unknown TOLERATED 0.15
vg0207177588 A -> DEL LOC_Os02g13440.1 N frameshift_variant Average:69.194; most accessible tissue: Minghui63 young leaf, score: 85.633 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207177588 NA 8.99E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.06E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 2.07E-19 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.17E-16 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.80E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.58E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 7.41E-36 mr1105_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.41E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 2.38E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 8.65E-13 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 5.39E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.36E-20 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 4.64E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 3.16E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 5.39E-27 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 2.21E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 3.42E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.10E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 2.41E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 5.48E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 1.02E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 3.09E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 2.52E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 4.42E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588 NA 4.19E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251