Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207177588:

Variant ID: vg0207177588 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7177588
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGTGGTTGCCTCCTTTACTGCCGGCCGCACCTCATCGTGCTGCGCCGGCCTCCACCACCGGACGCGCCTCTCGCGCCAGTTCGGCCTCCCGCCATCGGT[A/T]
ACGCCTCTCGCTCCAAGCGGGCCTCCTCGCCGCCGGCCACGCCTCTTGCGCCTTACTGGCCTCCACTGCCATCGGCTGCGCCTCTCTGCACCAAGCTGGC

Reverse complement sequence

GCCAGCTTGGTGCAGAGAGGCGCAGCCGATGGCAGTGGAGGCCAGTAAGGCGCAAGAGGCGTGGCCGGCGGCGAGGAGGCCCGCTTGGAGCGAGAGGCGT[T/A]
ACCGATGGCGGGAGGCCGAACTGGCGCGAGAGGCGCGTCCGGTGGTGGAGGCCGGCGCAGCACGATGAGGTGCGGCCGGCAGTAAAGGAGGCAACCACGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	29.10%	0.38%	13.61%	NA
All Indica	2759	81.10%	17.70%	0.40%	0.76%	NA
All Japonica	1512	3.50%	55.80%	0.40%	40.28%	NA
Aus	269	98.90%	0.40%	0.00%	0.74%	NA
Indica I	595	90.10%	9.90%	0.00%	0.00%	NA
Indica II	465	86.70%	12.50%	0.22%	0.65%	NA
Indica III	913	77.70%	20.30%	0.88%	1.20%	NA
Indica Intermediate	786	75.10%	23.80%	0.25%	0.89%	NA
Temperate Japonica	767	2.20%	81.70%	0.26%	15.78%	NA
Tropical Japonica	504	4.40%	18.70%	0.60%	76.39%	NA
Japonica Intermediate	241	5.80%	51.00%	0.41%	42.74%	NA
VI/Aromatic	96	79.20%	17.70%	0.00%	3.12%	NA
Intermediate	90	63.30%	26.70%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207177588	A -> T	LOC_Os02g13440.1	synonymous_variant ; p.Val158Val; LOW	synonymous_codon	Average:69.194; most accessible tissue: Minghui63 young leaf, score: 85.633	N	N	N	N
vg0207177588	A -> T	LOC_Os02g13440.1	synonymous_variant ; p.Val158Val; LOW	nonsynonymous_codon ; V158I	Average:69.194; most accessible tissue: Minghui63 young leaf, score: 85.633	unknown	unknown	TOLERATED	0.15
vg0207177588	A -> DEL	LOC_Os02g13440.1	N	frameshift_variant	Average:69.194; most accessible tissue: Minghui63 young leaf, score: 85.633	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207177588	NA	8.99E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.06E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	2.07E-19	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.17E-16	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.80E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.58E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	7.41E-36	mr1105_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.41E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	2.38E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	8.65E-13	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	5.39E-15	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.36E-20	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	4.64E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	3.16E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	5.39E-27	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	2.21E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	3.42E-12	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.10E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	2.41E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	5.48E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	1.02E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	3.09E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	2.52E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	4.42E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207177588	NA	4.19E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251