\
| Variant ID: vg0207161968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7161968 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCAATACAAGATTAATTAAAATTCGAAATAAAAATAAAATAAAATCCAAAATTAAAAAAGAAAAGGAGAGTCCAAGTAGAAATACAATTTAAAAATAGCT[A/G]
AAATTCGGAATTAAAAATAAAGAATATTGAAATAAGTTTCCATATAAGTACCCAATACGAGATTAATCAAAAATGAAATAAAAATAAAATAAAATCTAAA
TTTAGATTTTATTTTATTTTTATTTCATTTTTGATTAATCTCGTATTGGGTACTTATATGGAAACTTATTTCAATATTCTTTATTTTTAATTCCGAATTT[T/C]
AGCTATTTTTAAATTGTATTTCTACTTGGACTCTCCTTTTCTTTTTTAATTTTGGATTTTATTTTATTTTTATTTCGAATTTTAATTAATCTTGTATTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.00% | 19.70% | 0.68% | 12.63% | NA |
| All Indica | 2759 | 98.20% | 1.00% | 0.18% | 0.58% | NA |
| All Japonica | 1512 | 4.00% | 57.00% | 1.52% | 37.50% | NA |
| Aus | 269 | 96.30% | 1.50% | 1.12% | 1.12% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.00% | 0.65% | NA |
| Indica III | 913 | 98.20% | 0.70% | 0.33% | 0.77% | NA |
| Indica Intermediate | 786 | 97.80% | 1.40% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 2.30% | 81.60% | 0.52% | 15.51% | NA |
| Tropical Japonica | 504 | 5.60% | 22.20% | 3.17% | 69.05% | NA |
| Japonica Intermediate | 241 | 5.80% | 51.50% | 1.24% | 41.49% | NA |
| VI/Aromatic | 96 | 80.20% | 16.70% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 67.80% | 22.20% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207161968 | A -> G | LOC_Os02g13410.1 | upstream_gene_variant ; 4844.0bp to feature; MODIFIER | silent_mutation | Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0207161968 | A -> G | LOC_Os02g13420.1 | upstream_gene_variant ; 2854.0bp to feature; MODIFIER | silent_mutation | Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0207161968 | A -> G | LOC_Os02g13410-LOC_Os02g13420 | intergenic_region ; MODIFIER | silent_mutation | Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0207161968 | A -> DEL | N | N | silent_mutation | Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207161968 | NA | 1.35E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 5.77E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 5.10E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 9.01E-09 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 4.25E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 1.71E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 2.07E-15 | mr1741 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 5.58E-07 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207161968 | NA | 7.09E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |