\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207161968:

Variant ID: vg0207161968 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7161968
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATACAAGATTAATTAAAATTCGAAATAAAAATAAAATAAAATCCAAAATTAAAAAAGAAAAGGAGAGTCCAAGTAGAAATACAATTTAAAAATAGCT[A/G]
AAATTCGGAATTAAAAATAAAGAATATTGAAATAAGTTTCCATATAAGTACCCAATACGAGATTAATCAAAAATGAAATAAAAATAAAATAAAATCTAAA

Reverse complement sequence

TTTAGATTTTATTTTATTTTTATTTCATTTTTGATTAATCTCGTATTGGGTACTTATATGGAAACTTATTTCAATATTCTTTATTTTTAATTCCGAATTT[T/C]
AGCTATTTTTAAATTGTATTTCTACTTGGACTCTCCTTTTCTTTTTTAATTTTGGATTTTATTTTATTTTTATTTCGAATTTTAATTAATCTTGTATTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 19.70% 0.68% 12.63% NA
All Indica  2759 98.20% 1.00% 0.18% 0.58% NA
All Japonica  1512 4.00% 57.00% 1.52% 37.50% NA
Aus  269 96.30% 1.50% 1.12% 1.12% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 98.90% 0.40% 0.00% 0.65% NA
Indica III  913 98.20% 0.70% 0.33% 0.77% NA
Indica Intermediate  786 97.80% 1.40% 0.00% 0.76% NA
Temperate Japonica  767 2.30% 81.60% 0.52% 15.51% NA
Tropical Japonica  504 5.60% 22.20% 3.17% 69.05% NA
Japonica Intermediate  241 5.80% 51.50% 1.24% 41.49% NA
VI/Aromatic  96 80.20% 16.70% 0.00% 3.12% NA
Intermediate  90 67.80% 22.20% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207161968 A -> G LOC_Os02g13410.1 upstream_gene_variant ; 4844.0bp to feature; MODIFIER silent_mutation Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0207161968 A -> G LOC_Os02g13420.1 upstream_gene_variant ; 2854.0bp to feature; MODIFIER silent_mutation Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0207161968 A -> G LOC_Os02g13410-LOC_Os02g13420 intergenic_region ; MODIFIER silent_mutation Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0207161968 A -> DEL N N silent_mutation Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207161968 NA 1.35E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 5.77E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 5.10E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 9.01E-09 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 4.25E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 1.71E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 2.07E-15 mr1741 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 5.58E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968 NA 7.09E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251