\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207150816:

Variant ID: vg0207150816 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7150816
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTAAAATTTACAATAGGAGTGTTTGGGTAGAAAATTCACTGTTACCACCATTAAATCCTTCTAAAGAAGAGCATAGCTTAACTAGTTAGATTTCTT[A/G]
TGGTGGAACCAGCCCACCCAGATTCAAATCCTAGATTTGCATGGGTGCTCGCATTTACGGCTAATTATTCTTTCAGTGGTAGACGACGTATCCGTCGACA

Reverse complement sequence

TGTCGACGGATACGTCGTCTACCACTGAAAGAATAATTAGCCGTAAATGCGAGCACCCATGCAAATCTAGGATTTGAATCTGGGTGGGCTGGTTCCACCA[T/C]
AAGAAATCTAACTAGTTAAGCTATGCTCTTCTTTAGAAGGATTTAATGGTGGTAACAGTGAATTTTCTACCCAAACACTCCTATTGTAAATTTTACAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 10.30% 2.43% 13.73% NA
All Indica  2759 97.10% 0.10% 1.74% 0.98% NA
All Japonica  1512 24.00% 31.70% 4.10% 40.21% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 97.00% 0.00% 3.03% 0.00% NA
Indica II  465 98.70% 0.20% 0.22% 0.86% NA
Indica III  913 95.70% 0.00% 2.52% 1.75% NA
Indica Intermediate  786 98.00% 0.40% 0.76% 0.89% NA
Temperate Japonica  767 18.60% 59.30% 6.39% 15.65% NA
Tropical Japonica  504 20.80% 1.60% 1.19% 76.39% NA
Japonica Intermediate  241 47.70% 6.60% 2.90% 42.74% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 78.90% 6.70% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207150816 A -> G LOC_Os02g13400.1 downstream_gene_variant ; 279.0bp to feature; MODIFIER silent_mutation Average:75.953; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0207150816 A -> G LOC_Os02g13410.1 downstream_gene_variant ; 3548.0bp to feature; MODIFIER silent_mutation Average:75.953; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0207150816 A -> G LOC_Os02g13400.2 downstream_gene_variant ; 279.0bp to feature; MODIFIER silent_mutation Average:75.953; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0207150816 A -> G LOC_Os02g13400-LOC_Os02g13410 intergenic_region ; MODIFIER silent_mutation Average:75.953; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0207150816 A -> DEL N N silent_mutation Average:75.953; most accessible tissue: Minghui63 root, score: 82.511 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207150816 NA 2.39E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 4.19E-13 7.23E-45 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 1.10E-06 9.45E-18 mr1137 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 1.87E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 1.79E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 3.21E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 6.68E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 4.47E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 6.92E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 4.19E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 1.64E-09 5.01E-35 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 1.32E-13 mr1617 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 1.37E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 9.41E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 7.22E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 2.98E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 1.09E-09 1.23E-42 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 9.15E-14 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 4.29E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 3.53E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 3.73E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 1.19E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 5.36E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 2.22E-09 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 8.40E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 7.68E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 6.14E-07 4.50E-29 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 1.14E-09 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 9.39E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 2.81E-10 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207150816 NA 2.65E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251