\
| Variant ID: vg0207103437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7103437 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 108. )
TGGCGTTTTGGTGAGACCAAGCACTATATTAGCCCACATAACAAATTTAAAGGACTTGTTTGAACAATATGAAAGATTAAGGACTAAAATGACCCAGAAG[T/C]
GAAACTTTAGGGACCATATTAGATATTCTCCCATAAATCTACTCATCCTAATTCATATATAAAGGTAGTTGTATTTGAAGATGCAATTGATAGTGTAGTG
CACTACACTATCAATTGCATCTTCAAATACAACTACCTTTATATATGAATTAGGATGAGTAGATTTATGGGAGAATATCTAATATGGTCCCTAAAGTTTC[A/G]
CTTCTGGGTCATTTTAGTCCTTAATCTTTCATATTGTTCAAACAAGTCCTTTAAATTTGTTATGTGGGCTAATATAGTGCTTGGTCTCACCAAAACGCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 24.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 60.60% | 39.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.30% | 38.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 49.70% | 50.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 54.60% | 45.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207103437 | T -> C | LOC_Os02g13320.1 | upstream_gene_variant ; 2096.0bp to feature; MODIFIER | silent_mutation | Average:35.324; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0207103437 | T -> C | LOC_Os02g13310.1 | downstream_gene_variant ; 2828.0bp to feature; MODIFIER | silent_mutation | Average:35.324; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0207103437 | T -> C | LOC_Os02g13310-LOC_Os02g13320 | intergenic_region ; MODIFIER | silent_mutation | Average:35.324; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207103437 | NA | 5.99E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 4.52E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 5.09E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 9.81E-07 | mr1402 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 6.96E-06 | mr1509 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 1.58E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | 8.44E-08 | 8.44E-08 | mr1717 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | 4.09E-06 | 4.09E-06 | mr1770 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 2.46E-06 | mr1981 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 2.16E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 6.68E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 1.89E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207103437 | NA | 3.19E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |