\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207103437:

Variant ID: vg0207103437 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7103437
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCGTTTTGGTGAGACCAAGCACTATATTAGCCCACATAACAAATTTAAAGGACTTGTTTGAACAATATGAAAGATTAAGGACTAAAATGACCCAGAAG[T/C]
GAAACTTTAGGGACCATATTAGATATTCTCCCATAAATCTACTCATCCTAATTCATATATAAAGGTAGTTGTATTTGAAGATGCAATTGATAGTGTAGTG

Reverse complement sequence

CACTACACTATCAATTGCATCTTCAAATACAACTACCTTTATATATGAATTAGGATGAGTAGATTTATGGGAGAATATCTAATATGGTCCCTAAAGTTTC[A/G]
CTTCTGGGTCATTTTAGTCCTTAATCTTTCATATTGTTCAAACAAGTCCTTTAAATTTGTTATGTGGGCTAATATAGTGCTTGGTCTCACCAAAACGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 24.00% 0.04% 0.00% NA
All Indica  2759 60.60% 39.40% 0.07% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 61.30% 38.50% 0.17% 0.00% NA
Indica II  465 49.70% 50.30% 0.00% 0.00% NA
Indica III  913 70.80% 29.20% 0.00% 0.00% NA
Indica Intermediate  786 54.60% 45.30% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207103437 T -> C LOC_Os02g13320.1 upstream_gene_variant ; 2096.0bp to feature; MODIFIER silent_mutation Average:35.324; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0207103437 T -> C LOC_Os02g13310.1 downstream_gene_variant ; 2828.0bp to feature; MODIFIER silent_mutation Average:35.324; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0207103437 T -> C LOC_Os02g13310-LOC_Os02g13320 intergenic_region ; MODIFIER silent_mutation Average:35.324; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207103437 NA 5.99E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 4.52E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 5.09E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 9.81E-07 mr1402 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 6.96E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 1.58E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 8.44E-08 8.44E-08 mr1717 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 4.09E-06 4.09E-06 mr1770 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 2.46E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 2.16E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 6.68E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 1.89E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207103437 NA 3.19E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251